Busch Lab

ZMP

bbs10

Ensembl ID:
ENSDARG00000069515
ZFIN ID:
ZDB-GENE-060503-355
Description:
Bardet-Biedl syndrome 10 [Source:RefSeq peptide;Acc:NP_001082932]
Human Orthologue:
BBS10
Human Description:
Bardet-Biedl syndrome 10 [Source:HGNC Symbol;Acc:26291]
Mouse Orthologue:
Bbs10
Mouse Description:
Bardet-Biedl syndrome 10 (human) Gene [Source:MGI Symbol;Acc:MGI:1919019]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa28976 Nonsense Mutation detected in F1 DNA Not yet available
sa39189 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101238 Nonsense 2 565 3 4
ENSDART00000122549 Nonsense 4 567 2 3
ENSDART00000141069 None None 151 None 2
Genomic Location (Zv9):
Chromosome 18 (position 6843045)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7420735
GRCz11 18 7379670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACTATATATATATATTTGTGTGTGTGTGTGTGTTTATGTGTGTAGATG[C/T]AGCAGCAGCTGGAATGTGTGTCTCTGCAGGTGTGTGTGAGTGTTCTCGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa243
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101238 Nonsense 48 565 3 4
ENSDART00000122549 Nonsense 50 567 2 3
ENSDART00000141069 Nonsense 17 151 1 2
Genomic Location (Zv9):
Chromosome 18 (position 6842907)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7420597
GRCz11 18 7379532
KASP Assay ID:
554-2563.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGCGGCAGTGTGCTGTTCACTCGTGACACYGGGGAAACACTCATYAGC[A/T]GACATGGACAGARAGTTCTCAGCACACTACACCTAGAGCACCCTATGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101238 Nonsense 251 565 4 4
ENSDART00000122549 Nonsense 253 567 3 3
ENSDART00000141069 None None 151 None 2
Genomic Location (Zv9):
Chromosome 18 (position 6840537)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7418227
GRCz11 18 7377162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTGAATTGCGAGGTCCAATAAAAGCGCTAGTTTTATATGAGAGTTTT[G/T]GATCATCTCTTGGTGATAATATAACCGTATGCTTTCAGCAAGACTGGTTG
Associated Phenotype:
Not determined