Busch Lab

ZMP

TRIM65 (72 of 82)

Ensembl ID:
ENSDARG00000069514
Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33081 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5180
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101235 Nonsense 15 574 1 6
Genomic Location (Zv9):
Chromosome 3 (position 5208915)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4701810
GRCz11 3 4611940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGAAATGGCAGCAGCRRGTGTCTCCTGGGCCGAGGACCARTTCATGTR[T/A]CCAGTGTGTCTGGATCTCCTGAAGAGTCCAGTAACGATTCCCTGTGGACA
Long Flanking Sequence:
GAAGATAGTGCAGCCCTTGTCAAGAAGTTGAGTCCCAGAGTCCAAACTGTGTATGGAGGTGAGCCCAACTATCTAGTCGGTACTGTTAAACCCCATGCACAAGCTTACCCACTGAGGTGGCATACCATGTCCCAAAAGCCAGATTCTGTGTCTGACAATCAAGTCTTCGTGGTCCTGACTTTCGACCACCCCCTGTTCCACAACCCCTATAGGCCGGCATATAATGCTACTTTTCAAATTCGATTGTATATAAACTATCAACCTTTTTAGCAATTTATTCAATAATAATGCTTAAATTAATATATAAAAAATAAAGTAAATAAATAAATAGATTGTATGCTTGGATTAAAAATCTGCCGAAATCTGCACACATGGATTCCGTGTGGGCCTAGTCATCAGAAAGAAAAATAAACTCTGTATCTGATTAAATCGTCATCTGTGTGTTTCAACAGTGAAATGGCAGCAGCGGGTGTCTCCTGGGCCGAGGACCAGTTCATGTG[T/A]CCAGTGTGTCTGGATCTCCTGAAGAGTCCAGTAACGATTCCCTGTGGACACAGTTACTGCATGAGCTGCATCACAGACTGCTGGAATCAGGAGGAGCAGAAGCGAATCTACAGCTGTCCTTTATGCAAACAGAGCTTCACTCCGAGACCTGCTTTAGCTAAGAATGTGGTGTTTGCTGAAATGGTGGAGAAACTGCAGAAGAGCAGACTCCAGACGGCTGCTCCTGCTTCTGTTCACACTGGATCTGGAGATGTGGAGTGCGACGCCTGCACTGGAAATAAGCAGAAAGCTGTGAAGTCCTGTCAGGAGTGTAGAAACTCTTATTGTCCAGATCACCTCCAACATCACGAGAGTCTCTTCAGAGGTCGAGGACACAATCTGATGGAGGCCACTGGACGACTGCAGGAGATGATCTGCCCTCAGCATAATAAAGTGATGGAGATTTACTGCCGCACCGACCAGCGCTGCATCTGTATGCTGTGTTTGGTGGATGGACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33081
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101235 Nonsense 408 574 6 6
Genomic Location (Zv9):
Chromosome 3 (position 5199800)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4692695
GRCz11 3 4602825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGCATTGATCTGCGTGAGGGGAACACAATAATGACGGTCACAAACATT[C/T]GACAGCCGTATCCGGATCATCCACACAGATTTGATGCTTGGACTGAAGCC
Long Flanking Sequence:
ATCATCGTACTGAAATAAACCACGCCCCCTACTCAATATTTAGCTTCAGTTAATACATCATCATACTGAAATAAAACCACGCCCCCTACTTAATATTCAGCTTCAGTTAAAAATACATCATTATACTGCAATAAAAGCCTGCAGTGGCTTCAGGCCCACACATACAAATGTTTTAACATCATTAACGTTTGTATGCTGATGCATGTTCTTTGGTGTTCACAGTGAAAACCGTGCAGGTCGTCGTCTCTCGTGAACATGCCACCAGGAAAGAGTTTCTACAATGTGAGTTACTAAACATGCACAAGCACTGACAACCCTTGCATGACCAATGTTAGAGAACGATGCATAACTTTACATTAGTTAGTGTTGCGTTAGTAAGGTCATGAGTGATTGTGTGTTTCTCTCCTGCAGATTCTCATCCGCTGACTCTGGATCTGAACACTGTGAATTATTGCATTGATCTGCGTGAGGGGAACACAATAATGACGGTCACAAACATT[C/T]GACAGCCGTATCCGGATCATCCACACAGATTTGATGCTTGGACTGAAGCCTTGTGTAGAGAGCCTGTGACGGGCCGCTGTTACTGGGAGGTGGAGTGGGCCGGCACTGGGAGAAAAGGTGTAGATATAGGAGTGATGTACAGGAGCATGAAGAGAAAGGGAGATGGAAATGACAGCGCCGCTGGACGTAATGAAAAATCCTGGAGTTTGTTCTGCTCTCCTGAATATTGCTCATTCTGGCACAATAACCGTGAGACCGTCCTGCCTGTGAGCTCCGTTTCCAGTAAAATAGGAGTGTTGGTGGATCCCAGCGCAGGGGTTTTGTGTTTCTACAGCGTCTCAGACACATTAAGCCTCATTCACAGAGTCCAGACCACATTCACTCAGCCGCTCTATGCTGTGTTTGGATTAGACCGACAGACTGTGCTGAAACTGCCCAACCAGATCAATGATGCTGATATTATACAGCTTGCTATGTTATATCACACTCTGATGATGTCA
Associated Phenotype:
Not determined