Busch Lab

ZMP

hs6st3

Ensembl ID:
ENSDARG00000069500
ZFIN ID:
ZDB-GENE-070103-3
Description:
Heparan-sulfate 6-O-sulfotransferase 3 [Source:UniProtKB/Swiss-Prot;Acc:A0MGZ7]
Human Orthologue:
HS6ST3
Human Description:
heparan sulfate 6-O-sulfotransferase 3 [Source:HGNC Symbol;Acc:19134]
Mouse Orthologue:
Hs6st3
Mouse Description:
heparan sulfate 6-O-sulfotransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1354960]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa7632 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7632
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065929 Missense 205 419 2 2
Genomic Location (Zv9):
Chromosome 9 (position 30372939)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29528885
GRCz11 9 29339631
KASP Assay ID:
554-4359.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCTGCGAGACCCAGTGTCCCGCTACCWGAGCGAATGGAAGCACGTGCA[G/T]CGCGGAGCCACCTGGAAGACCTCGCTCCACATGTGCGACGGCCGTTCGCC
Associated Phenotype:
Not determined