Busch Lab

ZMP

si:dkey-83f4.1

Ensembl ID:
ENSDARG00000069484
ZFIN ID:
ZDB-GENE-081104-516
Description:
Novel protein similar to vertebrate DAB2 interacting protein (DAB2IP) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
DAB2IP
Human Description:
DAB2 interacting protein [Source:HGNC Symbol;Acc:17294]
Mouse Orthologue:
Dab2ip
Mouse Description:
disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI Symbol;Acc:MGI:1916851]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41139 Nonsense Mutation detected in F1 DNA Not yet available
sa9948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41139
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Nonsense 250 1162 6 16
ENSDART00000135812 Nonsense 237 1147 5 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12700598)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12145361
GRCz11 8 12183066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGCCCTCGGTCAAGAGCATCACCGTTCATCTTTACAAGGAAACGGAC[A/T]AAAAGAAAAAGAAGGACAAAAATAATTATGTGGGCCTGGTCAATATTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9948
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Essential Splice Site 359 1162 6 16
ENSDART00000135812 Essential Splice Site 346 1147 5 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12700267)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12145030
GRCz11 8 12182735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGGCGTGTGCACTTGTRCATATCTTACAAAGCACAGGCAAGGCCAAGG[T/C]AAGACCACTGCTTTTATAACTCATCGCGTATTATGCATGATTTATCAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27142
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Nonsense 374 1162 7 16
ENSDART00000135812 Nonsense 361 1147 6 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12681808)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12126571
GRCz11 8 12164276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTCAGGACTTTCTGACTGATCTGATGATGTCTGAGGTGGATCGTTGC[G/T]GAGACAATGAGCACCTCATCTTCCGTGAGAACACACTGGCCACTAAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3661
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Nonsense 869 1162 12 16
ENSDART00000135812 Nonsense 856 1147 11 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12667465)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12112228
GRCz11 8 12149933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGTAGTGGGGATGAATTTATTCAACGTCCTGGAGAGTTTACACGTCGA[C/T]AGCTGTCACTTACAGAGACCCAACACCAGACCAATGTACCGCGGCAGAAC
Associated Phenotype:
Not determined