Busch Lab

ZMP

slc13a3

Ensembl ID:
ENSDARG00000069478
ZFIN ID:
ZDB-GENE-040426-2486
Description:
solute carrier family 13 member 3 [Source:RefSeq peptide;Acc:NP_998067]
Human Orthologue:
SLC13A3
Human Description:
solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 [Source:HGNC Symbol;
Mouse Orthologue:
Slc13a3
Mouse Description:
solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38697 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21317 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101159 Essential Splice Site 333 596 7 13
Genomic Location (Zv9):
Chromosome 8 (position 29530014)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28672740
GRCz11 8 28681972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCAAATGCTGTTATTGATGAAGACTACAAGAAACTGGGCCCGATAAA[G/A]TAAGTCACTGAGCACTCACCTCTGTTGTGTTTTCGACATATTCATTCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101159 Essential Splice Site 401 596 9 13
Genomic Location (Zv9):
Chromosome 8 (position 29533323)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28676049
GRCz11 8 28685281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTCCATCTCAGCGTCCATCTCTCCGCTGGTGGTTCGATTCCAGAGG[T/G]CAGTGGGTGGTTTATTGACTTTCTGTATCCTGGTCTTACAGCAGCTGAGA
Associated Phenotype:
Not determined