Busch Lab

ZMP

frem1a

Ensembl ID:
ENSDARG00000069473
ZFIN ID:
ZDB-GENE-081119-1
Description:
Fras1 related extracellular matrix 1a [Source:RefSeq peptide;Acc:NP_001177237]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa27100 Nonsense Mutation detected in F1 DNA Not yet available
sa1148 Essential Splice Site Available for shipment Available now
sa34238 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13110 Essential Splice Site Available for shipment Available now
sa31619 Essential Splice Site Available for shipment Available now
sa41083 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9531 Nonsense Available for shipment Available now
sa41084 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 218 1684 5 37
Genomic Location (Zv9):
Chromosome 7 (position 72394154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69438889
GRCz11 7 69675037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTAAAATCCCCCCCCCCCTCCCCCTCCCCCATGCAGATAATAAAGCC[A/T]GAGCTCACTGTAAGACTGATGACTGCCTGAAGGGTCTCAAACTGCTGAAA
Long Flanking Sequence:
GCATGAATAGTCCTCACTTTCGATTAGGTCACAAAACTAGGTGAAGTTGAGTTAATAAAGCATTTATTAATATACATATATGCCTGAATAATAAGACATATAAACTTTGATTTCAATAGTTTTTTTTAATCATTTACTAACTCATTCTGAATGATCCTAAAAACCCTCATCTACTCTTAAATACCAATGGTTTGTAAATAATGCGGGACTTAATTTAGTAATGAAAAATAAATCATTAACAGAGTATGAAAATACAATCATTAATCACATTATATAGGTGCTTATAAGAATACAGCATTTGTAGCTGCAGTTATAAACTGCTTACTAACGCTTATTAATGTAGAGTTAACGCTTAACAAATAATGAGTTCACTATTTGCTAATGCTTAATAAATGATTTATAGTGTGTAGTTATTATAAAGTGTTACCAATATTACTGCAAATATACAGTTGAGTAAAATCCCCCCCCCCCTCCCCCTCCCCCATGCAGATAATAAAGCC[A/T]GAGCTCACTGTAAGACTGATGACTGCCTGAAGGGTCTCAAACTGCTGAAAATCACCAAAGTGCCATGCAATGACTTCCTGATGATGGGCATCCGCTACCAGCACACCGACCCTCCGTCTCCACATACAGACTACATCTCCATCAGACTGGACCTCACAGACACCCGGAGCAGGAGCATAATACAGGTGTTAATCCTAAATTCACATTACATTCACATTACTGTGTTGTCTCCATGCCAGATAAAGGTTTGGTATTAAAACAACAGGTAACTCTTTATTTGAAGGGGAAAATGAGGAGAGGAAAACCATGTCAGTCTGCTTCTTTATTCTTAATATAAAGTACAGATATTACTAGGGATGTAACGGTATCAGAATTTCACGGTTCGGTAATACCTCGGTATGAATGTCACGGTACGGTATTTATTGAATCATTTACAGGAAAAAACAAAACTTATGAAAATACTCCAAAAAAGTGCCAAAAGTGTCAATGACATACAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 387 1684 6 37
Genomic Location (Zv9):
Chromosome 7 (position 72395866)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69440601
GRCz11 7 69676749
KASP Assay ID:
554-1059.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCTTCCAGCCTCCCAACTCCAGCGCCACACATCGCAGGAACTACGAGG[T/C]GAAACACGAATGCTTTAACATACTGTTTGTTTTTTTTATTGTATTTTTTT
Long Flanking Sequence:
CGCTTCATTCGCCTGAGCAAATTTTCTCAGAAGACCTATAGTTTTACCGAGTCATGCGACTACGGTAATATCGAAAAAAATTAATATTGCGGTATTTACAATACCGTTACATCCCTAGATATTACACAACCCATTCTTTCATCTGAAGACTTAGTTCTGTCCATCTGTCCATCAGTCAGAGCAGGCCTGGATCCCGGTGACCATTACAGGCGCTCTCCCCAACCAGCCGCCCAAACCTGCCTTCATGTCCATGTTCATCCTGGAGGTGGATCAGTTCATCCTGACTCCTCTCTCCACTGCGACTGTGGACGCGGAGGACGACGAGACGCCCAAGCAGAGGCTGGTGTTCAACATCACTAAACCCCCCAGTGAAGGCTTCATTACTCACCTGTCGGACCACACCAAACCAGTGTCCTCCTTCAGCTGGACGGATCTGAATGGCATGCTGATCAGCTTCCAGCCTCCCAACTCCAGCGCCACACATCGCAGGAACTACGAGG[T/C]GAAACACGAATGCTTTAACATACTGTTTGTTTTTTTTATTGTATTTTTTTAAAGGGCCATGAAACCCCCTCGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGTCAGAAAAGTGGGCGTGTCCATCTCTGTTTAGGGGGGAGTGTCGGAGGAAGAAAAGTGGGATGGTGTGGGAGTGTCTATTTGGGCACGCGAGTTTCAGAGTCAAAACACACACACACACACAGTATAAAAGTGATGGTGTTTAACCCACATGGACATCTGTAGTCGAATTATTTGCCAAATTATTAAATGTTGGACTTTAACTGCAGTTTGGCTCTTTCATTCAGGGAACTCATTCATGCCCCTCGCGACAAACGAGATATTTGATTCGAGGATCTGCTCTAAGCGTGTATTTTTCATGCAATGTTTGATACCGCACGGCGAATGAGAGAAAAAAAACCTCAGTATTTTCCGGAAACTTAGATGCACACGACAGGTAGTGTCAGAAAGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1834
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 667 1684 11 37
Genomic Location (Zv9):
Chromosome 7 (position 72405484)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69450219
GRCz11 7 69686361
KASP Assay ID:
554-1825.1 (used for ordering genotyping assays)
KASP Sequence:
TATCGAGACACTTAGTCATCAATGAGACTGATGTTGTCTATTTGACCAAG[C/T]AACAACTGCACTTTGTAGATTTGGAGTCCCCAGATAGTGAGCTTACATAC
Long Flanking Sequence:
TTGGCAAAATATTTGACTGCATGTCACTGCATATCAAACGACTGAAACGATATAACTAGAGAAATCTCCACTGTGCTGCTGAGTGATTGAGAGAGCGCTTCTCACTGAACAGCGCAGCAGCGATGACGTAAGCGTGCCGAGGCCTGGTTGTGGTGTGAGTGCGGGCCGTCGGGGGAGACGGGAGGGGGGACAAGTGTGCTTTAGCCCGGTTCGAGGCAACTGTATCTAGTGTGAGTACGGCCTAAGTTTACCCATCTATGCTGAATTCTGCTACTGAGAAACCCAGAAATGTGAAAAGGGTCCATAGTAGGGGTATTCTAGCAGTCAATCAGATGTAAACTAGACTTTTTAAACTTTCTTTAATAATTAGATTATTACTATGTATTTTTCAGGTCATTGTGATTCAGATCCAGCCAGTGCCTGATCAGCCTCCACAAGAAGCTCCGGGTGTATCGAGACACTTAGTCATCAATGAGACTGATGTTGTCTATTTGACCAAG[C/T]AACAACTGCACTTTGTAGATTTGGAGTCCCCAGATAGTGAGCTTACATACACCGTCACCACCCCACCTTTCTACACCACCACCTATGGGTATAAAATCAATCACTTTGCATGAAAACACACGTTTTCCCAACAGGACAATTTAAAAAGTCCCCTGCAGAATTTGACTTGACGTGTTTGACTTGATTGTTTTAATTTGCAGAGGGTCTGATGCAGGAAGGTTGTTTCTGGTCGACAGCATCCCCAAATTTAGCAAAGACTCAAGCGCACCGATGCTGAGGCTTTTCACTCAGGTAAACACTCTGAGTTTGGGTTTAAATGTGCAGTTTGGACACCTAGTGGTTGAACTAGGTAATGCAGTCCAAATTCAAAAACTATTGGAGAGGGTACCACTCAATGCACAAGAAGGTTGCCAGATTGACAACCCACACAGTAGCGAGCTGCTCAGCTAATGTTTACATTTGTGATAATTATATTAGTTGCTAATTTAAAACCAGCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 782 1684 13 37
Genomic Location (Zv9):
Chromosome 7 (position 72407549)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69452284
GRCz11 7 69687527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCTGCTTTAACGTAACTGTTCTGCCAGTGGATAACCAGGCACCAGAG[G/T]TACAAGAACCCTTAATTACAAGAGTTAAAAAGTACTCACCCACACTTTGG
Long Flanking Sequence:
CACGTGCACACATAGGGCTCAACCTGTGCAGTGCACATGCCCTTTTTAGTCTTGGATAGAAAGTGCCCTTACAAAATGATCAAAAGTGCCCCCGCGACGCGACACACCCTCCGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCAGGAACAAGTTTGGCTCCAGGAACAAGTTTGGTGACCCCTGCTTTAGAAGAATCAAAACGTTCACCAGAAGCAACTGACGCTGTACACTATCCTCTTGGATGTGTCTGTAGCACGCAGTCAACTACATGAAAGTAGCTTACATGCCCCCCATCCCGGACATCGGACCGTACCCTCAGCACATCCAGTTTGTCCTGTCAGTGACCAACCAGCAAGGCAGCACGACCACCGGGATCTGCTTTAACGTAACTGTTCTGCCAGTGGATAACCAGGCACCAGAG[G/T]TACAAGAACCCTTAATTACAAGAGTTAAAAAGTACTCACCCACACTTTGGTCCAATTCCCTGAGACCTTTGTTCATCCTCAAAACACAAGTTAAGATATTTTAGATGAAATTCGAGAGCTCTCTTATCCTCCATATAGACAGAAATGCTCCGGAGATGCTTAAAGTCCTAAAAAGGAACCAAAACATTCAGTGTGACTTCAGCGGTTGAACAATAATTATATGAAGCTCCAAGAACACTTTTGTGCACCCTCCAAAAGAAAAAAACTATAAATAAACTTTGTTCGTCAGTCACATTTTTTTTTTCGTCAAGTGGTCAATGTGTTTAATGCGGGCTGCATGACATTCCTATTAGGGCCTACTCACACTATCCCATCCGTACCGTGCCCAGGCCCGTTTCCCGGATCGTTTGAGTGCGCTGAATCGGGCTCAAGCACAGTTCACTTGGCCGGCCCTGGCTCGGTTGGAAGAGGTGCGCCTGAGCGCGGTTCACTTGGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13110
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1093 1684 19 37
Genomic Location (Zv9):
Chromosome 7 (position 72416387)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69461122
GRCz11 7 69696159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATTGATGTATATTGAATCCTGATATCCTAATGWTGYTGTTCCTCGTTC[A/G]GCCTCGTTCACCTAYAGGGRTGTGTTGGATGGACACATTAACTATGTCCA
Long Flanking Sequence:
AACGTGGGAATCAGTATTGGTCAGTCGGTTTTGTTACCCTGCTAAAATCAACCCAGACTCATTGCTGATATGCCCCCAGATTTACATTTCTGGGGACAGCGAAATGCGAAACTGGACGTACATCTCTCACATGTCCTCTTCTTTCGTAAATTCACCAGAGGGCGCAATATAACCTTCAGCTGACCAGGCTAGCTTGTTGTCGACTGACTGACTGACTGACCCACCCCGTCCCTAAACCCAACCGATAGTGTTTTTAAATACACTCTAGTAAAAGTAAAGCCGTCACCTTGTGATTTCGCCATGTTTTCAGCCTGTTGTTTATTTATTTATTTATTTGTTCTTTGTTTTACCTGATTTCCGGAACCATTCTCTGCCATACTCAAACCCCGTTGTCGCGGTCAACTCCATTTCAGAATGCTGTATAATATATGTATACAGTTTTGTATATTGATATTGATGTATATTGAATCCTGATATCCTAATGATGCTGTTCCTCGTTC[A/G]GCCTCGTTCACCTACAGGGATGTGTTGGATGGACACATTAACTATGTCCAGTCCAGACACCAGAGGATGGAGCCCACCACTGACCAGCTCATGCTGCAGGTGTCTGATGGGAAACAGCAGTCATCTCCAGTCCCGCTTTACATCATCATCAGTCCAACTAATGACGAGATTCCAGACTTCCAGACTCAAAACATCACGGTGGGTCACAGGGACATTCGGTAACTCTCAGCTAACTGAGAATATTATTGCCTAAAGAGATGTGGTGGTGCAAAAAATAACCGGGTGGGCAAAAAAAAAAGAGTGGGATGAAAAATATTTTTTGTACGTTTTTGCATTCTTAAGTGTTTGCATTCCCCTGAGAAACGTTGCTTTCGCTTACCCTTTAAAGGTCCAGTCAAATTAAAATAACATTTTTTAGATGTTAGAATCAGTATGTTAGTCTGTGTAAAACAATGACAAAATATGCGTTTAGAAAATATAACACTGATATTAACATGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31619
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1158 1684 19 37
Genomic Location (Zv9):
Chromosome 7 (position 72416587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69461322
GRCz11 7 69696359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCCAACTAATGACGAGATTCCAGACTTCCAGACTCAAAACATCACGG[T/A]GGGTCACAGGGACATTCGGTAACTCTCAGCTAACTGAGAATATTATTGCC
Long Flanking Sequence:
CGACTGACTGACTGACTGACCCACCCCGTCCCTAAACCCAACCGATAGTGTTTTTAAATACACTCTAGTAAAAGTAAAGCCGTCACCTTGTGATTTCGCCATGTTTTCAGCCTGTTGTTTATTTATTTATTTATTTGTTCTTTGTTTTACCTGATTTCCGGAACCATTCTCTGCCATACTCAAACCCCGTTGTCGCGGTCAACTCCATTTCAGAATGCTGTATAATATATGTATACAGTTTTGTATATTGATATTGATGTATATTGAATCCTGATATCCTAATGATGCTGTTCCTCGTTCAGCCTCGTTCACCTACAGGGATGTGTTGGATGGACACATTAACTATGTCCAGTCCAGACACCAGAGGATGGAGCCCACCACTGACCAGCTCATGCTGCAGGTGTCTGATGGGAAACAGCAGTCATCTCCAGTCCCGCTTTACATCATCATCAGTCCAACTAATGACGAGATTCCAGACTTCCAGACTCAAAACATCACGG[T/A]GGGTCACAGGGACATTCGGTAACTCTCAGCTAACTGAGAATATTATTGCCTAAAGAGATGTGGTGGTGCAAAAAATAACCGGGTGGGCAAAAAAAAAAGAGTGGGATGAAAAATATTTTTTGTACGTTTTTGCATTCTTAAGTGTTTGCATTCCCCTGAGAAACGTTGCTTTCGCTTACCCTTTAAAGGTCCAGTCAAATTAAAATAACATTTTTTAGATGTTAGAATCAGTATGTTAGTCTGTGTAAAACAATGACAAAATATGCGTTTAGAAAATATAACACTGATATTAACATGTAGAGCTTGTGGTTTGTCACTTCCGCCTAAATGGATCAATGTTTTTTTTTTCACGTCACCTCATAATTCAGTTTCTCATCAAATCTTGAGCAATCAAATGCTCTCTAGTATCTGACATGCCCCGCCCCCTTCAAGATTCTTCTTATTTGCTTTTCAGTTGATGCGCTTGAGCTCAACCCCTCTCACTGGCAAACCTGTGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1229 1684 20 37
Genomic Location (Zv9):
Chromosome 7 (position 72418604)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69463339
GRCz11 7 69698376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGAGGAGCCTGTCCAGCATTTTTGCATGGATGACCTCAAGAGCGGCAA[G/A]TCTCAAATTTAAACATAAATATAAGCTTGCCAACTTTTTTTTTTTGACTC
Long Flanking Sequence:
AGAAAAAATAAAAGCAATACGAAGCAATTACTTGATCAGTGCGAATCATTATCTTATTGAATAAAGACAATAAACTAACAAAATTTTCTTTCGAATTGTGGTTTAGCAAAAGCATTAAATAAAGGGAACAATAAATGAAACTGGCTTTGACAAAATCGAAGAGTACCAACACATTTTTCCACATAAGAAATTGAATAAAGTGTTGTGTTTATAGCCTAGAGTTGGCTATCTGTATGCAGAAACATTGCAGTAGTTACTGTAAATGTGATCACAGGTTTTTGTCTTTAGGTTTTTGAAGGAGACAGGACAGAGTTAAACTCGTCTGTAATCAGTGCGGTGGATTTGGATGTTCCCCAAGAGCGTCTGATGTTCAGCATCGTCCAGAATCCTCAGCACGGCTCTATCATCAGTCTGCCACACAGAAATCAAGTCTCACATTACAAGCGTGGAGCTGAGGAGCCTGTCCAGCATTTTTGCATGGATGACCTCAAGAGCGGCAA[G/A]TCTCAAATTTAAACATAAATATAAGCTTGCCAACTTTTTTTTTTTGACTCGTACGTTATTAAATTTATAGTAAATACTGTAATGAAGTACTTGAGTAGTTAATGTGTTGTTGTAATTCTATAGTTACTGTAATATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTATGTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTCTGATGGAAAACACAAGCTCCAGAAACACGTGCAGGTGAAAATACTGCCTGTCAACGACGAGGAGCCGCAAATCATCCGGTAACTGCAGATGAATATCAGTAAAATAAATCATGCTGTGTTTTTATCCGTGCCATATAAATACCATAACCTTCTCTCTCCCTCAAAACGACTTTTCTTCACTTCCTGGTCATATGGATTGCCTTTAGGGTGGGGCTATCAGTGCTTTAGGGCAAGGCTATCAGTTAGTGTCTTGTTTCTGCTTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9531
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Nonsense 1234 1684 21 37
Genomic Location (Zv9):
Chromosome 7 (position 72418787)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69463522
GRCz11 7 69698559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTA[T/A]GTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTC
Long Flanking Sequence:
TAAGAAATTGAATAAAGTGTTGTGTTTATAGCCTAGAGTTGGCTATCTGTATGCAGAAACATTGCAGTAGTTACTGTAAATGTGATCACAGGTTTTTGTCTTTAGGTTTTTGAAGGAGACAGGACAGAGTTAAACTCGTCTGTAATCAGTGCGGTGGATTTGGATGTTCCCCAAGAGCGTCTGATGTTCAGCATCGTCCAGAATCCTCAGCACGGCTCTATCATCAGTCTGCCACACAGAAATCAAGTCTCACATTACAAGCGTGGAGCTGAGGAGCCTGTCCAGCATTTTTGCATGGATGACCTCAAGAGCGGCAAGTCTCAAATTTAAACATAAATATAAGCTTGCCAACTTTTTTTTTTTGACTCGTACGTTATTAAATTTATAGTAAATACTGTAATGAAGTACTTGAGTAGTTAATGTGTTGTTGTAATTCTATAGTTACTGTAATATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTA[T/A]GTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTCTGATGGAAAACACAAGCTCCAGAAACACGTGCAGGTGAAAATACTGCCTGTCAACGACGAGGAGCCGCAAATCATCCGGTAACTGCAGATGAATATCAGTAAAATAAATCATGCTGTGTTTTTATCCGTGCCATATAAATACCATAACCTTCTCTCTCCCTCAAAACGACTTTTCTTCACTTCCTGGTCATATGGATTGCCTTTAGGGTGGGGCTATCAGTGCTTTAGGGCAAGGCTATCAGTTAGTGTCTTGTTTCTGCTTTGAATTGATCCAAGATTTACGTCACCATATAGCAGAAAAAAGGACAATCTTAACTTCCATTTCATCACAACTTTAAAGACCTTAAGATTTTTTGTTTAATTGTTTGTCATAAAGGTCATACATGTCAACCCAAGCTCATTCTGAAAACGTAGTCTCGTTGATGTTTCTGGAGACCGCAAAATACATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18899
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site 1277 1684 21 37
Genomic Location (Zv9):
Chromosome 7 (position 72418917)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69463652
GRCz11 7 69698689
KASP Assay ID:
554-6162.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTGAAAATACTGCCTGTCAACGACGAGGAGCCGCAAATCATCCGG[T/G]AACTGCAGATGAATATCAGTAAAATAAATCATGCTGTGTTTTTATCCGTG
Long Flanking Sequence:
TAAACTCGTCTGTAATCAGTGCGGTGGATTTGGATGTTCCCCAAGAGCGTCTGATGTTCAGCATCGTCCAGAATCCTCAGCACGGCTCTATCATCAGTCTGCCACACAGAAATCAAGTCTCACATTACAAGCGTGGAGCTGAGGAGCCTGTCCAGCATTTTTGCATGGATGACCTCAAGAGCGGCAAGTCTCAAATTTAAACATAAATATAAGCTTGCCAACTTTTTTTTTTTGACTCGTACGTTATTAAATTTATAGTAAATACTGTAATGAAGTACTTGAGTAGTTAATGTGTTGTTGTAATTCTATAGTTACTGTAATATACTTAAGTTTATAATGTGTCTCTGTCCACAGGCATGACTCTGATGTATGTACACGATGACTCTGAGAGTGAGCAGGATGAATTCATCCTTCAGCTCTCTGATGGAAAACACAAGCTCCAGAAACACGTGCAGGTGAAAATACTGCCTGTCAACGACGAGGAGCCGCAAATCATCCGG[T/G]AACTGCAGATGAATATCAGTAAAATAAATCATGCTGTGTTTTTATCCGTGCCATATAAATACCATAACCTTCTCTCTCCCTCAAAACGACTTTTCTTCACTTCCTGGTCATATGGATTGCCTTTAGGGTGGGGCTATCAGTGCTTTAGGGCAAGGCTATCAGTTAGTGTCTTGTTTCTGCTTTGAATTGATCCAAGATTTACGTCACCATATAGCAGAAAAAAGGACAATCTTAACTTCCATTTCATCACAACTTTAAAGACCTTAAGATTTTTTGTTTAATTGTTTGTCATAAAGGTCATACATGTCAACCCAAGCTCATTCTGAAAACGTAGTCTCGTTGATGTTTCTGGAGACCGCAAAATACATCCCAGGAGTTACGTATTTTTGCAGTTTTTACGAATCCGCGAGGGACCGCTGTGTGCGCATTTTCATATCTCAAATTTCTCTCGTTAGTGCCGTTCATGCCCGCTGTTCTTGCGTAAACCCACCAGAGGCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090165 Essential Splice Site None 1684 29 37
Genomic Location (Zv9):
Chromosome 7 (position 72431335)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69476070
GRCz11 7 69717425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGGAAAGACTTTATACCAGCTTCATCTCTGATTCAGTTTGACCCAGG[T/C]AAACAAAAATATGCTGAATATTGCATGATAGTGGGTGACATTGCGGAAAT
Long Flanking Sequence:
TAGCATCTAGTAAGAGCTTGATTAGCTGGTTCAGGTGTGTTTGATTAGGGTTGGAGCTAAACTCTCAAGGACACCGTCAGTCCAGGACCAGGTTTGGACACCCCTGGTCTATACTGTAATAGAGCATTGGAGTATATTAAGATATATTGAAGTGTATTAGGATGTGTAATGTACTTTCTCTGTCAGATTGAACTTCAGCTGGGCCGGTGTTGAGCTGACCAGGACTCAGTATACAGTATGTGAAAGTCAAGGCTCAGTTTCACTAACCATCCAGAGGAAAGGAAACATGCAGGACTCCTCTTATGTGACCGTACAGGTGGGTAGGACAGAATTTGACAGCTTTAAAAAAATATTTCCATGCAGAAATGTGTATAATACGTCTATGTGTTCTACTAAAAACAGATTTGTAAAGTATATAATTCCTCACAGGTGAAAGAGCTCACCGCATCTGCTGGGAAAGACTTTATACCAGCTTCATCTCTGATTCAGTTTGACCCAGG[T/C]AAACAAAAATATGCTGAATATTGCATGATAGTGGGTGACATTGCGGAAATATAAACACAAATTCATTGAGATGTCACTGCAGGATAATGCAAAATTAGCTCATTCGCTAAAGCTAATTTGCTAAAGCTAAGCTAATTCGCAGCTTATATCACTGCTAGCAAAACTTAGACCTGTTTTTTTTCCAGGGGTGGCCAGTCGAGTTTGGAAAGTGGAGATTGTTCAGGACTCATTGGAGGAAGCGGATGAGAAATTTGAGGTTAGCTTGGCGTCTCCTGTAGCTGCGGTGCTGAAGGACAATTCAAGAGCCACAATCTCCATTAAAGACTCAAATGGTTTGTGTTTAAGTTGTCAAGAAAGCTAAACATTTATAGTCAGTGTTTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAAGGGCAGTGT
Associated Phenotype:
Not determined