Busch Lab

ZMP

si:xx-bac7cse.2

Ensembl ID:
ENSDARG00000069472
ZFIN ID:
ZDB-GENE-030616-4
Description:
hypothetical protein LOC368477 [Source:RefSeq peptide;Acc:NP_001082817]
Human Orthologue:
CHSY3
Human Description:
chondroitin sulfate synthase 3 [Source:HGNC Symbol;Acc:24293]
Mouse Orthologue:
Chsy3
Mouse Description:
chondroitin sulfate synthase 3 Gene [Source:MGI Symbol;Acc:MGI:1926173]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9987 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4366
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101142 Nonsense 300 821 3 3
Genomic Location (Zv9):
Chromosome 10 (position 16696983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16787712
GRCz11 10 16745696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTATTATGAAGTTACTAATATAGTGTTGTTTCCTTCTGTCTGTAGATG[C/T]AGCAGTTGTTCTATGAGAACTATGAGCACAACAAGAAAGGTTTCATCCAG
Long Flanking Sequence:
GCTACTAAAAAACTATTTGATTTAGAAAGTAGCCACACTATCGCTACGCTACTGAAAAATGTCAATAAGCTGGTAGCGCCTCTACTTGTAGCAACGCTACTGTCCATTGCCCAGGCCTGTTGTTTTGTATTCATCTCTACACTTTTGCCTTCCATCTTGTTATACAGCACAGTGGTCAACTATTATTGCGTTAATTTGTGCTTTATAAGTAAATGAAAAAGAAGTGAATTTAACTAGAACTACACCACTATTCTACAATGACTCTGTTGCCTACCTTATATGCTACAATGTTCCACATTCTCAAATATTATGGCTCTCAAATATAATATTAAGCCAAACAAGCTTTATATATATATATATATATATATATATATATATATATATATATATAGTTTGACTGAATTTACATTGTCAAAACATTATAGAAATAACTTGACTTGACTTGAACATAATTATTATGAAGTTACTAATATAGTGTTGTTTCCTTCTGTCTGTAGATG[C/T]AGCAGTTGTTCTATGAGAACTATGAGCACAACAAGAAAGGTTTCATCCAGGAACTTCACAGTAGCAAGATCCATAACGCCATCACGCTGCACCCCAACAAGCGTCCAGCTTACCAGTACCGGCTGCACAGCTACCTTCTCAGCCGGAAGATCTCTGAGCTGCGGTACCGCACTATTCAGCTACACCGTGAAGGAGTCACTATGAGCCATCTCAGCAACACTGCTGTGCAGTGGGAGGACCAGCTACTAGGTGCGCCACCTTCCTACACTCGCTACCGGCCCACAGAGCGTGAAGAAGTCATCGAGTGGGACTTCGTTACCGGCAGGCACCTGTACTCCACCGGTGAGAAGCAGATGCCCCGTCAGGGACTTGGAAGCCTGGTCCGCTCAGCATTAGAAGACACAGTGCTTCAAGTGATGGAAATGATCAATGAGAACTCCAAAACTCGAGGCCGCATCATAGATTTCAAAGAGATCCAGTATGGTTATAGACGAGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9987
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101142 Nonsense 810 821 3 3
Genomic Location (Zv9):
Chromosome 10 (position 16698513)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16789242
GRCz11 10 16747226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCGAGCACTTACGCATCCAYAATGCAGTTGGCCGAWTTGTGGTTGTCC[A/T]AACATTTAGGCATTGGTTATAACAGGACTTCCTCCTGATGCTCCACCCAG
Long Flanking Sequence:
GCTCTTCTCAACTGAGGAACAACTCGCTGTTGTTTTTCTGCGACGTGGACCTGGTCTTTAACACCGATGCCCTTCAGAGGTGTCGAGACAACACCATTGAGGGAAGCCAAGTCTATTTCCCTGTCGTCTTCAGTCAGTATGATCCCAAAATAGTCTATGCCGGTGACCCTCCAGAAGACAGCAACTTTGTTTTTACCAAAAAAAGTGGATTTTGGAGGGATTATGGATTTGGGATCACCTGCATATTCAAAAGCGACTTGCATAAAGCTGGCGGGTTTGACACTGCAATACAAGGCTGGGGTCTAGAAGATGTCGATTTGTTCACGAAAGTCATTAATTCTGACTTGAAAGTGTTTCGCTCTCAAGAACCAGGTATTGTGCATATTTATCACCCAGTCTTTTGTGACACACATTTAGAGCCCAAGCAATACAAAATGTGCGTTGGATCCAAAGCGAGCACTTACGCATCCACAATGCAGTTGGCCGAATTGTGGTTGTCC[A/T]AACATTTAGGCATTGGTTATAACAGGACTTCCTCCTGATGCTCCACCCAGTCCTAATGCAGAAATCACTGGAGTTTACCTCAGATCTGCAAGCAGCAATCCATTTAGTGTATGTGTGAGTATCTGTAGGGATTCTGGGTGAATGTATGTCATATTGGTACACTCCAGCTACTTCAGAGCAACGTTTGCTATAAAGTCTCTTACAGCATCTTCCAAAGTATATTTATTAGACAGGTCTGAAAAGTCCCTTTAGGGCTCATGCTGTCTTTTCCCATCTGTTCATATGGTCAGGTGCATGCTCATGTCATGAAAACCACGATTGATGTGGTTGATTTGAATTTAATGAGGTCCTAAGGCAATGGTCTCAAACAGGATCCTTGGAGGGCCACAGCTCTGCACAGTTTAGCTTCAACCACCTCCAACTCACACCTGCTTATTAATCTCTAGTCGTCTTGAACACCTTGATTAGTTGGATCAACTGTGTTTGAAAAACCGTGTAGA
Associated Phenotype:
Not determined