Busch Lab

ZMP

igsf9bb

Ensembl ID:
ENSDARG00000069467
ZFIN ID:
ZDB-GENE-091112-15
Human Orthologue:
IGSF9B
Human Description:
immunoglobulin superfamily, member 9B [Source:HGNC Symbol;Acc:32326]
Mouse Orthologue:
Igsf9b
Mouse Description:
immunoglobulin superfamily, member 9B Gene [Source:MGI Symbol;Acc:MGI:2685354]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44968 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37311 Nonsense Available for shipment Available now
sa37310 Nonsense Mutation detected in F1 DNA Not yet available
sa32349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Essential Splice Site 415 1339 9 19
ENSDART00000142907 Essential Splice Site 415 1325 9 18
Genomic Location (Zv9):
Chromosome 21 (position 24020038)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24705712
GRCz11 21 24742317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCCTCGGTACCATGGGACCGTCCCCTCCCGCCCCCCTGGTGCTAAAGG[T/C]AAGGATAAAACCTTGTAGCTGCACCATTATTTCATTTGTTTGCGTCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37311
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 434 1339 10 19
ENSDART00000142907 Nonsense 434 1325 10 18
Genomic Location (Zv9):
Chromosome 21 (position 24019911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24705585
GRCz11 21 24742190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCCAAATTTTTGGTGGTTCCTGGAGGGGAGTACAGGCAGGAGGCTGGT[C/T]GAGAGCTGGTCATCCCCTGCGAGGCAGAAGGAGACCCATTCCCCAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37310
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 1132 1339 18 19
ENSDART00000142907 Nonsense 1132 1325 18 18
Genomic Location (Zv9):
Chromosome 21 (position 23981493)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24667167
GRCz11 21 24703772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAGCCTCAGGGCCTTCCAGCCAAGCGTTTACCTATGCAAGAGGCA[C/T]AGAGTCTAGGGCAGCTAAGACACACAAGCCACGGTATGGGTGTACCGGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29594
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 1172 1339 18 19
ENSDART00000142907 Nonsense 1172 1325 18 18
Genomic Location (Zv9):
Chromosome 21 (position 23981371)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24667045
GRCz11 21 24703650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCACATGGTTGGCCCAAGCTCGTTCGGAAGCCTGGACACAAGATGGTA[C/A]GAGCTTACACCCAGGCTTAGCCCCAGGCAGCCCCGTAGGATGGAACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32349
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101136 Nonsense 1271 1339 18 19
ENSDART00000142907 Nonsense 1271 1325 18 18
Genomic Location (Zv9):
Chromosome 21 (position 23981076)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 24666750
GRCz11 21 24703355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCTTCTCCTGCTCAAGGCCAAGGCAGCCGAAGGGCAAGTCCCAGCTAC[C/T]GATCCCACATGGCATTTGCCACCTCAGCGGCAAGCTATCCGTCACAGTCC
Associated Phenotype:
Not determined