Busch Lab

ZMP

tnk2b

Ensembl ID:
ENSDARG00000069433
ZFIN ID:
ZDB-GENE-030131-7427
Description:
tyrosine kinase, non-receptor, 2b [Source:RefSeq peptide;Acc:NP_001073486]
Human Orthologue:
TNK1
Human Description:
tyrosine kinase, non-receptor, 1 [Source:HGNC Symbol;Acc:11940]
Mouse Orthologue:
Tnk1
Mouse Description:
tyrosine kinase, non-receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1930958]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44662 Nonsense Mutation detected in F1 DNA Not yet available
sa40895 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 356 732 8 14
ENSDART00000135313 Nonsense 357 733 8 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27681500)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26284439
GRCz11 7 26555632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTGTATGCTGTGATGCGCAAATGTTGGGCCTGCAATTCTACTGAA[C/T]GACCGACCTTCGCACAGCTCACCACCATGGTATCAGAGGTCAGTGTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40895
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Essential Splice Site 400 732 9 14
ENSDART00000135313 Essential Splice Site 401 733 9 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27682453)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26285392
GRCz11 7 26556585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGACTCTCTCTACAGGCAAATGATCTAGTGACTGTAATAGACCATGGG[T/G]AAGAGTGGGGGTGGAAGGCTGGAAGGATAAAACAAAAAAAATCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20947
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 409 732 10 14
ENSDART00000135313 Nonsense 410 733 10 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27683493)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26286432
GRCz11 7 26557625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGGCTGTGCTTTTATGTAGGTTGGATATGTGCGAGTGGAAGGGA[C/T]AGAACCAGAGGACTCTGAGTGTTGGCTGGTTTCCCCCTGCGTTAACAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2401
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089856 Nonsense 690 732 14 14
ENSDART00000135313 Nonsense 691 733 14 14
ENSDART00000140528 None None 123 None 4
ENSDART00000141353 None None 183 None 4

The following transcripts of ENSDARG00000069433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27690116)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26293055
GRCz11 7 26564248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAAAGATTTTCCTGATATCTTCAGACAGACCAGCTGTATTACATGAAT[C/T]AGTGCACTCGTGAGGAATGTCAGAAAGTCCTCTCACGCTACAACTGGGAC
Associated Phenotype:
Not determined