Busch Lab

ZMP

zgc:153463

Ensembl ID:
ENSDARG00000069420
ZFIN ID:
ZDB-GENE-060929-804
Description:
GTP-binding protein ARD-1 [Source:RefSeq peptide;Acc:NP_001070112]
Human Orthologue:
TRIM23
Human Description:
tripartite motif-containing 23 [Source:HGNC Symbol;Acc:660]
Mouse Orthologue:
Trim23
Mouse Description:
tripartite motif-containing 23 Gene [Source:MGI Symbol;Acc:MGI:1933161]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15670 Nonsense Available for shipment Available now
sa21681 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27574
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032 None None 423 2 12
ENSDART00000127581 Nonsense 49 576 2 11
Genomic Location (Zv9):
Chromosome 10 (position 11805118)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11880984
GRCz11 10 11839222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTGGTGTGTGTGAGGATGTGTTTTCACTACAAGGTGATAAGGTACCA[C/T]GACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACACGACTG
Long Flanking Sequence:
TGAACGTACGTATGCGTTTTGTATAATATAACAATTGTTATTATATATTATAATATATAATATAAACGTTTTAGAATTTAATTTTATTCTTTGTTTTTGCTGAAATATTTTTTCAAATAACAAATAAATTGTAATTAACAAAAGCTTAATTGGCTTTTTGAATGAGAAGTTAATAATTTAAAATGAAGGATGTGATGATATTCTTCATTATTGTTATGTGCATATACTAGTGATTCAGCATGTTAAAAATGTGGGATGGGACTTGATTTTGTCAGTCTCAAACTAATTGAAGGATTGGTTGTTTGTTATTTTCTATTTGTGGACATCATGTAAGTTAAAGGCCTGTCTTTTTATTAAAATAAAATTCACTCAGAAATGTCTACACAAATAATAATCTGCAACATTTCCTGTAAGAAATACATGTTTTTTTTGTTGACTTAAAGGTGTTGGAGTGTGGTGTGTGTGAGGATGTGTTTTCACTACAAGGTGATAAGGTACCA[C/T]GACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACACGACTGCCTCTCCACGGCAGGGCAGTACGCTGCCCCTTTGATAGACAGGTCACTGAGCTGGGTGAGTTTGCCTTTCTGTTCACTATAATAACAATGTAACTCAATATTTAAAAATTTCCATACTGGGAAGAATCATATTCTTGTTTTGCTCTCCAGGAGACTCAGGTGTGTGGGGCCTGAAGAAGAACTTTGCCTTGCTAGAACTGCTTGAACGGCTACAGAATGGGGCAACCAATCAGTCAGGCATGTCGGAGGATGCGCTTCGTGAGATGGGAGAGGTTAGAAGTGTACATTTTTCAAATTTACAGTTTTTTTTTATATTAGCAATATAGCTACAAACAAAAAATGAAGTATAAACATGATCTAATGTGCTGCATTTCAGATTCCATACCATCTGTCCTAAATGGATCTCTAAATGAGTTTAAAAACAAAATCTTGGCAGTGATTATGGGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15670
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032 None None 423 2 12
ENSDART00000127581 Nonsense 64 576 2 11
Genomic Location (Zv9):
Chromosome 10 (position 11805073)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11880939
GRCz11 10 11839177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCACGACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACA[C/T]GACTGCCTCTCCAYGGCAGGGCAGTACGCTGCCCCTTTGATAGACAGGTC
Long Flanking Sequence:
TATTATAATATATAATATAAACGTTTTAGAATTTAATTTTATTCTTTGTTTTTGCTGAAATATTTTTTCAAATAACAAATAAATTGTAATTAACAAAAGCTTAATTGGCTTTTTGAATGAGAAGTTAATAATTTAAAATGAAGGATGTGATGATATTCTTCATTATTGTTATGTGCATATACTAGTGATTCAGCATGTTAAAAATGTGGGATGGGACTTGATTTTGTCAGTCTCAAACTAATTGAAGGATTGGTTGTTTGTTATTTTCTATTTGTGGACATCATGTAAGTTAAAGGCCTGTCTTTTTATTAAAATAAAATTCACTCAGAAATGTCTACACAAATAATAATCTGCAACATTTCCTGTAAGAAATACATGTTTTTTTTGTTGACTTAAAGGTGTTGGAGTGTGGTGTGTGTGAGGATGTGTTTTCACTACAAGGTGATAAGGTACCACGACTGCTGCTGTGTGGACACACGGTGTGTCACGACTGCTTGACA[C/T]GACTGCCTCTCCACGGCAGGGCAGTACGCTGCCCCTTTGATAGACAGGTCACTGAGCTGGGTGAGTTTGCCTTTCTGTTCACTATAATAACAATGTAACTCAATATTTAAAAATTTCCATACTGGGAAGAATCATATTCTTGTTTTGCTCTCCAGGAGACTCAGGTGTGTGGGGCCTGAAGAAGAACTTTGCCTTGCTAGAACTGCTTGAACGGCTACAGAATGGGGCAACCAATCAGTCAGGCATGTCGGAGGATGCGCTTCGTGAGATGGGAGAGGTTAGAAGTGTACATTTTTCAAATTTACAGTTTTTTTTTATATTAGCAATATAGCTACAAACAAAAAATGAAGTATAAACATGATCTAATGTGCTGCATTTCAGATTCCATACCATCTGTCCTAAATGGATCTCTAAATGAGTTTAAAAACAAAATCTTGGCAGTGATTATGGGGATAGAATCCTCTTTGTCCAACTTGTTCCTCCTTACACTATGTGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032 Essential Splice Site 242 423 8 12
ENSDART00000127581 Essential Splice Site 395 576 7 11
Genomic Location (Zv9):
Chromosome 10 (position 11774968)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11850834
GRCz11 10 11809072
KASP Assay ID:
2260-2986.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCGATCACATTCAGCTGGATGCAGGCATCCCTGTTACTTTCACTAAGG[T/C]ACTGTTAATCATATAGATCATTGTTGAGAGAAAAAGAAATGCATGTTACT
Long Flanking Sequence:
ATCATAGTCTTTTTCTTAATGCATTTACACCAGAGGTTTTCAGTAAACTCCTCATTGGTTTCCACACAGGTTCCAGGTACTGCAGAAAGCGCCCGGTCTTGCGTGCGTGCCTACTTTGCAGATCTACATGAGACACTGTGTCGCCAAGAGGAGATGGCTCTGAGTGTGGTGGACGCACACGTCCGAGAAAGGCTGATCTGGCTTCGCCAGCAGCAGGAGGATATGACCATACTGCTGTCTCAGGTGTCCACAGCCTGCCTGCACTGCGAGAAAACACTGCAGCAGGTACAATCTAAGGCATGCTAAGTCACACAACCAGCATGATCAAAAGATCAGGAATTTGAGTTTGTTGTTTTTGTGCCAGGATGATTGCAGGGTGGTTTTGGCGAAACAGGAGATCAACCGGCTGCTGGAGACACTGCAGAAACAGCAGCAGCAGTTTACAGAGCTGGCCGATCACATTCAGCTGGATGCAGGCATCCCTGTTACTTTCACTAAGG[T/C]ACTGTTAATCATATAGATCATTGTTGAGAGAAAAAGAAATGCATGTTACTGTCAGTGATGTACAAGATGGATTTTTTAACTTAATTTACTAACTTTAAAAAATGATGAATGGTATTTGTAGCTCTCTTGCAGGGATGCCCACACCTTTTCAGCATGCGAGCTACTTATAAAATGACTAAGTCAAATTGATCTACCCAATATAAAAATGCAAAACATATATTACTTTTGTGACAATATTGAGATCCTGTATTGAGAATCCTGTATTTGTACAATCTATATATATATTGATGTACCTTGCATAACTGTATGAACCCATATTGTGCAAAAGCCTACAACTCTGTACATATTTTTGTCGTTACCTTACTCTGATGACTTGCACTGAATGGAATCAGCCTGGGAAGTATAGTTCGGACAGTAGCTGCTGATAGCCAGCCTCAAGCACATTACCAAATGATTATCAGTCATGGTGGAATGATATTTATGCTGTTGGCATAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27573
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101032 Nonsense 386 423 12 12
ENSDART00000127581 Nonsense 539 576 11 11
Genomic Location (Zv9):
Chromosome 10 (position 11756891)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11832757
GRCz11 10 11790995
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTCTGTGGAGGAGATGACAGAGCTTCTCAGCTTGCACAAACTGTGCTG[C/A]GGGCGCAGTTGGCACATTCAGGGCTGTGATGCCCGCAGTGGGATGGGACT
Long Flanking Sequence:
TGAGCAAATGAAAAACAGCCGTTTTCTTCAGTTTCCTTTTTTGTTTAAAAACTGATATGGATTGGACGGAAGATACCCTAATTCTATAACCTATAACACACCTATAGCTAGTTAAGAAAATAAGCTCAACCCTTTTAGACCATGCGCCACAACGCAAAGTGGATTTTTCTGTCCTTAAATTAGCAAAAATGGATTCCGAAACGCCCTTAATGCATTTGTGCCCTGCACCCCACGCTTTGCACTTTGTGCATGGATCGTCAAAATAGAGCCCTAGGTGTCTATAGTGACAGGTTTCGAAGCTTCGACTGTTTTGGTGTTTCATGAAGTCTCGCTCAGCCCACCACAGCTGACAACATTGTCATTTGTATTAATTTGTTTAGTTTTCATCTGGATTTTAAACTCCTGTTCAAATGTTTCTAATTGGTGTCTCTGTAGGACGTCCCTGGTGCAGTGTCTGTGGAGGAGATGACAGAGCTTCTCAGCTTGCACAAACTGTGCTG[C/A]GGGCGCAGTTGGCACATTCAGGGCTGTGATGCCCGCAGTGGGATGGGACTCCATGAGGGCCTGGACTGGCTCTCTCGCCAGCTGGTGGCTGCTGGGGTTCTGGATGTGGCCTGAGGGACTCTTCTACTCAAAAGACTTAAACCTGAAGCCTGTCCATGTCATTTGCACAGTCACTCAGATTATGTTTACCCACAATACCACGTCTTCATCCATTAGTAGATATACTACTGTGCTTGTGGCTCAATGGTGTACATAAATAGGAGTGCTTTAAGGGGTTAGTTCACTCCAAAATGACAATTGCTGTTTCAAAGACATTTTATGAAGATGGTTTTAATTGAAATTATCAGATTTCTTTCTCTCCTCGCGTTTTGGGTAAAAAGAATTTCAATGAAGAGACAGAAATGGTTCAAATTTGATTAAAAAATATATTGATTTGTGTTCTGAAGTCTAATTAAAGTGTTATCTGGTGGAAACAATATAATGGTGAACAAATATAACAG
Associated Phenotype:
Not determined