Busch Lab

ZMP

si:dkey-242g16.2

Ensembl ID:
ENSDARG00000069377
ZFIN ID:
ZDB-GENE-030131-8324
Human Orthologues:
PPP1R3B, PPP1R3C
Human Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 3B [Source:HGNC Symbol;Acc:14942]
protein phosphatase 1, regulatory (inhibitor) subunit 3C [Source:HGNC Symbol;Acc:9293]
Mouse Orthologues:
Ppp1r3b, Ppp1r3c
Mouse Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 3B Gene [Source:MGI Symbol;Acc:MGI:2177268]
protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene [Source:MGI Symbol;Acc:MGI:1858229]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27588
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100903 None None 362 None 2
ENSDART00000132206 Essential Splice Site None 283 None 3
ENSDART00000144841 Splice Site None 234 None 3

The following transcripts of ENSDARG00000069377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 18018733)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 18031079
GRCz11 10 17988513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTAAATAGGTTTAATAACCTTATCTTAACTTGTGTTTTTTTATTTTC[A/T]GCAGACATTCCATTTCACCATCATCCGTATCTGAGGTTCATCTGATAACC
Long Flanking Sequence:
GTAAAATGGCATGCCTAACATGCCTTCCCCTTCCCTCTCGTCACTCATTCAATAAAAAGTGATCGCCAACTTCAAACGCATGGTGGGATGGGATGATTTTACTTTCGTTGAGACTGACATTGATTCATCAGCTGTACTGTACATGCTGTCCTAACGCTCAAATACACGTGACGAAATAAAACCACGCCCTCTTTGAATGCGCTTTAAAAGCATCGAGAAGCGAGAGAGGGGTAGAAAACACACAGCTTGAGTGAGAGAGTTCGAGCGCGGCTTCATTGAATGACAAAGAGTGATGTTTACTTCCTACAACTACTCATGTCGTGTATTTCCTTGGCAATGACCGCTTTTCTACATTAGGACGCTGAGGACAACTTATTTGAGCACTCATTTAAAAAATAAAGGTACGTGAAGGAACCTTAGATATTCTGCAGGATTTATAACCACCAGTCGTTTGTAAATAGGTTTAATAACCTTATCTTAACTTGTGTTTTTTTATTTTC[A/T]GCAGACATTCCATTTCACCATCATCCGTATCTGAGGTTCATCTGATAACCAAAAATGAGCATCACAAAGTAAGTTTAGTTGTTCACTGCACACAATAATACATGTGATATCACAAAAAGCAAAACAAATATTTTTGTTCTTGTTGTTGTTAGGTTACAATATGATTTAAATATAATTTATTAGTTGTTTTTTTTACATTTAATATATTTTAATATTGTTTATAATTTAATGACCTGTTGTCATAACAATAATAGTCAATCATTCTTAATTTTATATCATTATATATATTTTTTTTAAATCAGCTTAAATTTAGACTATATTTTCTGACTCTTGGAAATTATTGCATGTATTCCAAATTGTCTAATTGTATTTTTTCTCTGTGTTTTACAGGCAGTATGTTTTAAGTAGCAACCCTTTCCCTGAGCATGTGATGCCAGTTGATCTGTCCATGAATGCACAGATCACCTCTTTCGCTTCCAGGTCCTCTACAGACCGGCACA
Associated Phenotype:
Not determined