Busch Lab

ZMP

sh2d4b

Ensembl ID:
ENSDARG00000069374
ZFIN ID:
ZDB-GENE-090313-53
Description:
Novel protein similar to human and mouse SH2 domain containing 4B (SH2D4B) [Source:UniProtKB/TrEMBL;
Human Orthologue:
SH2D4B
Human Description:
SH2 domain containing 4B [Source:HGNC Symbol;Acc:31440]
Mouse Orthologue:
Sh2d4b
Mouse Description:
SH2 domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:1925182]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31920 Nonsense Available for shipment Available now
sa2711 Nonsense F2 line generated Not yet available
sa11975 Nonsense Available for shipment Available now
sa7371 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31920
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 100 450 2 8
ENSDART00000144045 Nonsense 100 441 2 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21744042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21473380
GRCz11 13 21603830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCATACGAGCTGATTGTCAAAGAGCTGATGGAGGAAAGAGCCAGGCGA[C/T]AGGCTCAACTAGAAGCCCAGGAGCTCTGGTAAGGACTAGGACCAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2711
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 136 450 3 8
ENSDART00000144045 Nonsense 136 441 3 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21744440)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21473778
GRCz11 13 21604228
KASP Assay ID:
554-3316.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAGASATGCCAWCACAAAGGAAAAAGCGCGCCTAGTTGCAGGCAAGTG[G/A]AAGGAAGAAGCAGAGGACAGGAAGGCAGCCAAGCAGGAAGAGGAACGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11975
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Nonsense 236 450 5 8
ENSDART00000144045 Nonsense 236 441 5 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21753063)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21482401
GRCz11 13 21612851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGCTGGGCAAGAGATGAGTATAAGCGTCAGTCACTRCGAGCCATWGAG[A/T]AAGGTCATGTAGCTGGTCTGAGYGGCCACTTCCAGAAACAATCCCAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100895 Missense 360 450 7 8
ENSDART00000144045 Missense 360 441 7 7

The following transcripts of ENSDARG00000069374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 21761818)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21491156
GRCz11 13 21621606
KASP Assay ID:
554-4027.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTCCTAAAGGCATCATCTCTCGRGAGGACTCAGAGACCCTGCTTATGA[A/T]TGCTRCTGTGGGCTCTTTCTTGGTACGGGTCAGTGAAAGRATATGGGGCT
Associated Phenotype:
Not determined