Busch Lab

ZMP

LPHN2 (1 of 4)

Ensembl ID:
ENSDARG00000069356
Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Human Orthologue:
LPHN2
Human Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Mouse Orthologue:
Lphn2
Mouse Description:
latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

Alleles

There are 14 alleles of this gene:

Allele Name Consequence Status Availability
sa41780 Nonsense Mutation detected in F1 DNA Not yet available
sa21847 Nonsense Available for shipment Available now
sa13747 Nonsense Available for shipment Available now
sa9378 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21848 Nonsense Available for shipment Available now
sa41781 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41782 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2614 Nonsense F2 line generated Not yet available
sa41783 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21849 Nonsense Available for shipment Available now
sa9239 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41780
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 36 1436 1 20
Genomic Location (Zv9):
Chromosome 11 (position 7774302)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7618405
GRCz11 11 7628244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGTTATCCCATCGACCTACGCTGTCCAGGAAGTGATGTCATCATGATC[G/T]AGACTGCTAATTACGGTCGGACAGACGACAAGATCTGTGATGCTGACCCC
Long Flanking Sequence:
TGCGCTTGTTTTCCGGTGCATCCGTGCTTCATTTCGCATGTCAGATTAATTTCTAAATATAGAGATATATTTAAGGTCAGGTCCTGTGATTCGCCGAATGTGTTTTATTTGTGTTTGACATTAGTGTGATGAGGGAAATGCCCTTTACATGCTCCTCTGAGCGCAGTACCAGATTTCACTGTCAGCCCAGATATTTGACGCTCTTCACATTAGCAGAACACGGCACACGTATCGATTTTTATATCTCTCCCATTGTCTAGCCTTTCCCACTCTTTCATAAACTGGAGAGAAATGCATTTAGTAGCTCTTATTTTTTTTTGCATTCTGTTATTTTCTTCCTAAAAAAAAAAAGATAAATCACAATAATAAAGAAAGAAATCTCTCTCTGTCTTACAGGGTTTAGCCGGGCAGCCATGCCATTTGGCCTGGTGAGGCGGGAGCTGTCATGTGAGGGTTATCCCATCGACCTACGCTGTCCAGGAAGTGATGTCATCATGATC[G/T]AGACTGCTAATTACGGTCGGACAGACGACAAGATCTGTGATGCTGACCCCTTTCAAATGGAGAACATCAACTGCTATCTGCCTGATGCGTTCAAGATCATGTCCCAAAGGCAGGTTTTTCACATTCCTTCCCTCTCATTTGCTTTGATTGCACAGCGCATGAATAACAGGAAAATTTCCCTCCAACAATCTCAACAACCAAACCAAACAGATCTCAGCGTGTCTCATATCCGAGGTTCTCTTTGAGTTTCAACTGTGCTGCATCTGGAGGCTTGTGCTGAAAAACAGGAAGTGATGCGCGAGCCGGGCTTTGATACGTATTGTCGCGGGAGTGGCGCACGGTTCCGCTCAGCTTATTATAAGACATGGTGGAAATAGGTTTTGGAAAATGTGGCGTCTCAATTAGTCCTTTCAGCTGCAGGCAATTAGGCGTCTCAAGTGGGTGCTAATCTACACAGGAACTCTAGGCTGGGATTTGCCTCTGTAGGTCTGCAGAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 173 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798323)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7642426
GRCz11 11 7652265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATACACTTATTGAGTACAACTCGCTCGATGATTTTCAAAACTCTCGA[C/T]AGACTACGACGTATAAACTACCCCATCGGGTCGATGGCACGGGATTTGTG
Long Flanking Sequence:
GATTTCTCCATCACTCCCCTTCAGTATGTCCGAGCAGCAGTGAGCTGCTTGCTTACGGACACATAAAAAACCTGTTTCTGCTTCCGTTTAAGCTTCAATAACCTTCAGATGCAGATTCTTCGCACCTTTTTTTACTGCTTGTGAATGTGGGTAGCTGTTAGACTTCTTAGTGTGTGTTTCTGTCTTCACTGACTGCCCATTTATCAGAGTGATGTAGAGTCAGATGGCCCTTTGCCCTCTGCTTTCAACTGGCGTGAGCTGCGCTTGCTTATGTTTGACTGTTTTCTGCTCTGTTCTTCCCATCACTAGTTTTTGTTTGTCCTGGAACTCTGAAAGCGGTTGGAGATCCGTCGTTTCTATACGAAGCGGAGCAACAAGCGGGGTCGTGGTGCAAAGACCCTCTCCAGGCTGGGGACAAGGTTTATTTCATGCCCTGGACCCCTTACAGAACAGATACACTTATTGAGTACAACTCGCTCGATGATTTTCAAAACTCTCGA[C/T]AGACTACGACGTATAAACTACCCCATCGGGTCGATGGCACGGGATTTGTGGTATATGACGGAGCGGTGTTTTTTAACAAGGAGAGGACACGTAACATTGTCAAATTTGACCTTCGGACTAGAATTAAAAGTGGGGAGGCGATTATAAATAACGCAAACTATCATGACACTTCGCCGTATAAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTTGATGAAAATGGCCTCTGGGTGATCTACGCCACCGAGCAGAACAACGGTATGATGGTGATCAGCCAGCTCAACCCCTACACCCTCCGCTTTGAGGCCACCTGGGAGACCACATACGACAAGCGGTCGGCCTCCAACGCTTTCATGATCTGCGGAGTTCTCTATGTGGTGCGATCCACCTACGAAGACAACGAAAGTGAGGTCAGCAAGAGCCTGATCGACTACATGTACAACACCAAACTGAACCACGGCGAATACGTCGACATCCACTTCCCCAACCAGTACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13747
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 232 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798502)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7642605
GRCz11 11 7652444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGGGAGGCGATTATAAATAAMGCAAACTATCATGACACTTCGCCGTA[T/G]AAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTYGAYGAAAATKGCCT
Long Flanking Sequence:
CTGTCTTCACTGACTGCCCATTTATCAGAGTGATGTAGAGTCAGATGGCCCTTTGCCCTCTGCTTTCAACTGGCGTGAGCTGCGCTTGCTTATGTTTGACTGTTTTCTGCTCTGTTCTTCCCATCACTAGTTTTTGTTTGTCCTGGAACTCTGAAAGCGGTTGGAGATCCGTCGTTTCTATACGAAGCGGAGCAACAAGCGGGGTCGTGGTGCAAAGACCCTCTCCAGGCTGGGGACAAGGTTTATTTCATGCCCTGGACCCCTTACAGAACAGATACACTTATTGAGTACAACTCGCTCGATGATTTTCAAAACTCTCGACAGACTACGACGTATAAACTACCCCATCGGGTCGATGGCACGGGATTTGTGGTATATGACGGAGCGGTGTTTTTTAACAAGGAGAGGACACGTAACATTGTCAAATTTGACCTTCGGACTAGAATTAAAAGTGGGGAGGCGATTATAAATAACGCAAACTATCATGACACTTCGCCGTA[T/G]AAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTTGATGAAAATGGCCTCTGGGTGATCTACGCCACCGAGCAGAACAACGGTATGATGGTGATCAGCCAGCTCAACCCCTACACCCTCCGCTTTGAGGCCACCTGGGAGACCACATACGACAAGCGGTCGGCCTCCAACGCTTTCATGATCTGCGGAGTTCTCTATGTGGTGCGATCCACCTACGAAGACAACGAAAGTGAGGTCAGCAAGAGCCTGATCGACTACATGTACAACACCAAACTGAACCACGGCGAATACGTCGACATCCACTTCCCCAACCAGTACCAGTACATAGCCGCTGTGGAGTACAACCCCAGGGACAACCAGCTCTACGTGTGGAATAACTTCTACATTCTGCGCTACAATCTGGTGTTTGGGCCACCTGATCCAGCTCACGGTAAGCCCCGTCTCAAATCCGTCTAGCTGCACACACACATAGTCTCTCCCTGGATATCTGTTTAAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 376 1436 3 20
Genomic Location (Zv9):
Chromosome 11 (position 7798934)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7643037
GRCz11 11 7652876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACATTCTGCGCTACAATCTGGTGTTTGGGCCACCTGATCCAGCTCACGG[T/G]AAGCCCCGTCTCAAATCCGTCTAGCTGCACACACACATAGTCTCTCYCTG
Long Flanking Sequence:
CTTCGGACTAGAATTAAAAGTGGGGAGGCGATTATAAATAACGCAAACTATCATGACACTTCGCCGTATAAGTGGGGCGGGAAAACAGACATTGACTTGGCGGTTGATGAAAATGGCCTCTGGGTGATCTACGCCACCGAGCAGAACAACGGTATGATGGTGATCAGCCAGCTCAACCCCTACACCCTCCGCTTTGAGGCCACCTGGGAGACCACATACGACAAGCGGTCGGCCTCCAACGCTTTCATGATCTGCGGAGTTCTCTATGTGGTGCGATCCACCTACGAAGACAACGAAAGTGAGGTCAGCAAGAGCCTGATCGACTACATGTACAACACCAAACTGAACCACGGCGAATACGTCGACATCCACTTCCCCAACCAGTACCAGTACATAGCCGCTGTGGAGTACAACCCCAGGGACAACCAGCTCTACGTGTGGAATAACTTCTACATTCTGCGCTACAATCTGGTGTTTGGGCCACCTGATCCAGCTCACGG[T/G]AAGCCCCGTCTCAAATCCGTCTAGCTGCACACACACATAGTCTCTCCCTGGATATCTGTTTAAGTGGTCGCAAGATTTCAGCCACTGAGTTGGTATTCCTCTGGCACCCAAGTCTGTGTGTCAAATGTCACGGATGACTGATTTTTAATTTCAGATTTAATATGTGCTTGATGTATTCCGGAAACCTTTCTCGAGTGCAAAGCAACATCTCGGTGAAGTGGTGGGTCTCAGCAGTAAACAACATCCTAGGCGTTGTTAGCATATAATAAGAGACGCATCCCTCAGGATTTCAAAAGACAGAGCCATTCCTCTCTGGTGTTTAGACTCCAGGGGCTAAACTCCGTCCCGCTGAGAAGGATACCGCTTTCCTCATTGGTAGAAGTTTACCTGTCTGGACAGGAACGTCGGCAGCCTTGCAGCAACAGTAGCTCACCCCCCAGTAGAGTGGATCTCGTTCCCTAACCACCTCAAAACAGATTACACTTTTACTCGCAGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21848
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 581 1436 7 20
Genomic Location (Zv9):
Chromosome 11 (position 7827635)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7671738
GRCz11 11 7681577
KASP Assay ID:
2260-3939.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAATAAAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATA[T/G]ATGAAGGTATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCA
Long Flanking Sequence:
GTCTGTCTAATCTGTTTATTTGACGACTGGTCTAGTTTTGGGCTATTCTGTTAGATTTTCACCGACAGCCCAAGTTTAGCCTTGTTTTAGCAAGCTGTCTACGTTTATATGTCTATTAGACATCTATTAAACACTAAAATGTTCACTGGGTGTAAATTTCAATCCCCAACCCTGATCTTTGTGTGCATATTTTGCATGTTACAGATAGTTAATAAGTTATTGATTTTATTTTGAACTTAATTTAAAAGCGCTTGTGGATTTTTTTATGTTTTATTTTTTTATTTTTGGCTATACACCCAAACATCCATTGGTCACGTGATTTCATCAAAGCAGATCCAACTGCTTAACTCTGTTTCTGAACTTCTTTTGGATTGGAGAAGTCATTAGTACATCATCAGCCTTTCTAACTGTGTTTCTTTGGTCTGTTTTTGTTCTTGTGTGTGTCCTCTCTCAAATAAAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATA[T/G]ATGAAGGTATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCACATCTTTTTTTCCCTGCTCTTTATCCTCAGCATGGTCCTGTCTCCCTTCATTCTCACTGTCGCCAAAGCATTTCACTCCGCCAGTGTCCTCATTTCTGGAGGTTCGATATTTCAGTGGATTGGAAATTATGTGGCTGCAATTTTTATGCCCAATTCACACCTTTTATGTGTTTGTTGGTGGTCTTTATATTTATTTATATGTATTTTTTTTCAGTTTCTTTCTTGTTAAAGTCATGTGTTAATATTTGTTGCTCGATTTGCAGGTTGGCGATGCATGTGTTGTTGTTGTTGCGCTTAAATTGATCTTTTTTGGTTGTACAAGGGTAGATGCCAATTTCTGAGCTGTCGAAAGATTTTAGACCAAAGAAACTAACAATAAAGTTTGACTAAATGCATAACTCTGTTTTGGAAACGCAAATCAGTGATTGTGAAACTCCTGACTGTGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41781
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 583 1436 7 20
Genomic Location (Zv9):
Chromosome 11 (position 7827642)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7671745
GRCz11 11 7681584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATATATGAAG[G/A]TATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCACATCTTT
Long Flanking Sequence:
TAATCTGTTTATTTGACGACTGGTCTAGTTTTGGGCTATTCTGTTAGATTTTCACCGACAGCCCAAGTTTAGCCTTGTTTTAGCAAGCTGTCTACGTTTATATGTCTATTAGACATCTATTAAACACTAAAATGTTCACTGGGTGTAAATTTCAATCCCCAACCCTGATCTTTGTGTGCATATTTTGCATGTTACAGATAGTTAATAAGTTATTGATTTTATTTTGAACTTAATTTAAAAGCGCTTGTGGATTTTTTTATGTTTTATTTTTTTATTTTTGGCTATACACCCAAACATCCATTGGTCACGTGATTTCATCAAAGCAGATCCAACTGCTTAACTCTGTTTCTGAACTTCTTTTGGATTGGAGAAGTCATTAGTACATCATCAGCCTTTCTAACTGTGTTTCTTTGGTCTGTTTTTGTTCTTGTGTGTGTCCTCTCTCAAATAAAAAAAAAAAGCTTCAAAAGCGAGAAAGGACGTGCAGGGCATATATGAAG[G/A]TATATCTGTGCTACGCTACTATGGTCTTGTTTCTGTACTTCCACATCTTTTTTTCCCTGCTCTTTATCCTCAGCATGGTCCTGTCTCCCTTCATTCTCACTGTCGCCAAAGCATTTCACTCCGCCAGTGTCCTCATTTCTGGAGGTTCGATATTTCAGTGGATTGGAAATTATGTGGCTGCAATTTTTATGCCCAATTCACACCTTTTATGTGTTTGTTGGTGGTCTTTATATTTATTTATATGTATTTTTTTTCAGTTTCTTTCTTGTTAAAGTCATGTGTTAATATTTGTTGCTCGATTTGCAGGTTGGCGATGCATGTGTTGTTGTTGTTGCGCTTAAATTGATCTTTTTTGGTTGTACAAGGGTAGATGCCAATTTCTGAGCTGTCGAAAGATTTTAGACCAAAGAAACTAACAATAAAGTTTGACTAAATGCATAACTCTGTTTTGGAAACGCAAATCAGTGATTGTGAAACTCCTGACTGTGAAGCTGCATGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2621
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 645 1436 8 20
ENSDART00000091550 Essential Splice Site 645 1436 8 20
Genomic Location (Zv9):
Chromosome 11 (position 7830531)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7674634
GRCz11 11 7684473
KASP Assay ID:
2260-3940.1 (used for ordering genotyping assays)
KASP Sequence:
GACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTA
Long Flanking Sequence:
CTTTATCCTAATGGACATTTGCATTTATAAGGCATCACAAACAGCTGTCTTTCTTTACCTCACATGTGTCTGTTTATGTACTTGAAGAGCCTTTGACATTCAATACTGCACTCTTCAGACTAACAGAGCATGTCAGGCTCATTTCTGCAGCCTTGTTTTTTTTTTTATGTGTGTCACCTGATAACGACCTAAAACAAAGTGTGCATGTTTGCTTTCATTCGGGCACGGGCAGACAGCTGCTGATAAAGTCAAGGCTTTGACATTTGACCTTACTACAGTGGTTAGTGCTGACACAAGCGTCTCATTGGGCTGCAGGCTATCGTGGATACAGTCGACAACCTCCTCAGACCGGAGGCTCTGAAATCGTGGCGAGATATGAATACCACGGAGCAGACGCACGCCGCAACCATGTTACTGGACACCCTGGAGGAAGGAGCCTTTGTCCTTGCTGACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTAGCTTAATCCGCAGCTGATCACTTTGACTTTTCAAACCTGCTTTAGCTGGGAAATTGTATTGCAATAGCATCTAAAATAAAAGATAGATGGCATAGAAATACAGCGCATCTGGAAAGTATCCATACCTCTTCCCTTTTTCCATATTGTTTATGTTACAGCCTTATTCCAAAATGGATTAAATTCATTTATTTTCTCAAAAGTCTACACACAATACCCCATAATGACAATTCTCAATTCAATTGTTGCAAATTTATTAAAAATAAAAAACCTGAAAAATCACATGTACATATTCACAGCCTTTGCTCAATAGGATTTAGGTCTGGGCTCTAGCTGGGCCACTAAAGGACATTCACTTGTTGTTGTGAAGCCACTCCATTGATATTTTGGTGCTGTGCTTTGGGTCATCGTCCTGGTTGAAGATGAACCGTCGCCCCAGTCTGAGGTCAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18999
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 645 1436 8 20
ENSDART00000091550 Essential Splice Site 645 1436 8 20
Genomic Location (Zv9):
Chromosome 11 (position 7830531)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7674634
GRCz11 11 7684473
KASP Assay ID:
2260-3940.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTA
Long Flanking Sequence:
CTTTATCCTAATGGACATTTGCATTTATAAGGCATCACAAACAGCTGTCTTTCTTTACCTCACATGTGTCTGTTTATGTACTTGAAGAGCCTTTGACATTCAATACTGCACTCTTCAGACTAACAGAGCATGTCAGGCTCATTTCTGCAGCCTTGTTTTTTTTTTTATGTGTGTCACCTGATAACGACCTAAAACAAAGTGTGCATGTTTGCTTTCATTCGGGCACGGGCAGACAGCTGCTGATAAAGTCAAGGCTTTGACATTTGACCTTACTACAGTGGTTAGTGCTGACACAAGCGTCTCATTGGGCTGCAGGCTATCGTGGATACAGTCGACAACCTCCTCAGACCGGAGGCTCTGAAATCGTGGCGAGATATGAATACCACGGAGCAGACGCACGCCGCAACCATGTTACTGGACACCCTGGAGGAAGGAGCCTTTGTCCTTGCTGACAATTTAATGGAACCAGCCATTGTGAAAGTACCAGCCAGTAATATAAG[T/A]GAGTACGAGCAATGCACAGAACTAATAGAACTGACAACATATATACTGTAGCTTAATCCGCAGCTGATCACTTTGACTTTTCAAACCTGCTTTAGCTGGGAAATTGTATTGCAATAGCATCTAAAATAAAAGATAGATGGCATAGAAATACAGCGCATCTGGAAAGTATCCATACCTCTTCCCTTTTTCCATATTGTTTATGTTACAGCCTTATTCCAAAATGGATTAAATTCATTTATTTTCTCAAAAGTCTACACACAATACCCCATAATGACAATTCTCAATTCAATTGTTGCAAATTTATTAAAAATAAAAAACCTGAAAAATCACATGTACATATTCACAGCCTTTGCTCAATAGGATTTAGGTCTGGGCTCTAGCTGGGCCACTAAAGGACATTCACTTGTTGTTGTGAAGCCACTCCATTGATATTTTGGTGCTGTGCTTTGGGTCATCGTCCTGGTTGAAGATGAACCGTCGCCCCAGTCTGAGGTCAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 754 1436 10 20
Genomic Location (Zv9):
Chromosome 11 (position 7833671)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7677774
GRCz11 11 7687613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGTATTTATATCGGAGCCTGTGATTTTCACCCTGGAGCACATCGACG[T/C]GAGTGCAAGCAATAAACAAACAAAGCGATCGTAAAAGCAGCGGGATAGCA
Long Flanking Sequence:
GTTTAGGGATAATTCAGCAGCAAATCAAGCATAAGATGATTGCAAACATACTAAGAACCATTTTTTTTATTAAATGTACATGATAACAAGTCACAGTGGGAATTGTCATGATTGTCAAAATGTCTTTCTCTTAATAGGCTTCATTTTCATTTGCGCAGAACATAATTTCCCATTTTTTCTCCATTAATTTTGGCGTGAACTAAAACCCAGAGGTGTTCTTGACAGTTTTTGTGAGGCTCACTGACATAATAGACAGTAATGAGAAGTAAGTTTTGCCATTTTTTGCTTTGCAGGTGTTGCCAAGTTGGTGTTCGCCCTTTATAAGAACCTGGGGCAGTTTCTAAGCACTGAGAATGCAACAATGAAACTCGGCCAGGAGGTCAACGGACGCAACCTCTCGGTGGCTGTGAATTCTGACGTCATCGCCGCATCAATAAACAAAGAATCCAGTCGTGTATTTATATCGGAGCCTGTGATTTTCACCCTGGAGCACATCGACG[T/C]GAGTGCAAGCAATAAACAAACAAAGCGATCGTAAAAGCAGCGGGATAGCAAAGCAAGGCGGCAAATAAAGGGAAAATAAAAGCAGTCTCAATTCAAACACCCTACAAGGTCACAGAGGGGTTTATTTAAGCCATCGAACACGAAATTAACAAAGTCTAAACCAATGATTATTACCAGCCTAGACCAAATTCTTAATGAAAACTAATTCGTTTGTCGACATTAGGATGTAAATGATGCAATTTCCTTTTTTTGGAGTGGAAAATTAACTCCCAGATTAGCTATACAATGCAGGATGAAATTACCAGAGGACCAATTATCATCGCGCTCTCTTTTAAAGTGTCAGGAGCGTTCCCAGAGGAGACCCGGCTTGATTTTTGCTCTCTATCAAAGTAATTGTGTGATTTCCACAGACATGCCTTCAAACCATTCTGCCCCCTGTTAGCACCTCATATAATCAATGGTCCCGTGCAAGATTTCGCACTCATTTAACCTTATTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2614
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 904 1436 13 20
Genomic Location (Zv9):
Chromosome 11 (position 7842540)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7686643
GRCz11 11 7696482
KASP Assay ID:
554-3314.1 (used for ordering genotyping assays)
KASP Sequence:
ATCGCAGGGATACTGCATTACTTCTTTTTGGCGTCCTTTGMCTGGATGTG[T/A]CTGGAAGGAGTTCAGCTGTATCTGATGCTGGTGGAGGTCTTTGAGAGTGA
Long Flanking Sequence:
AAATAAATAAATAAATAAATAAATAATAACAGTAAAATAAAAAACAAAACAAAAAATAAAAAATAAATAAATAAATAAACAAATGAACGAACGAACGACCGAGAAAATCATGTATTACCTTGATTGGACATGGTGAAAATTATCTAATTTAATTTAGTTTATTTAACTTTATTTATTTAATTTATTTGTTTTAATTTAAGATAATTTCATTTTATGATTGAAGGAATAAATAGATGAATAAGTTAAAATAAATGAATGAATTAAAATAAACAAACAAACAAACAAACAAACAAACAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAGCAACTTAGAGTATACATTTTTAAACTCAATACAGTTTGCAGTTTATTTGTCTCTGACACTTCTGTCTTTTTTCCTCTCACAGTTGGCCTGCTCCATAATCGCAGGGATACTGCATTACTTCTTTTTGGCGTCCTTTGCCTGGATGTG[T/A]CTGGAAGGAGTTCAGCTGTATCTGATGCTGGTGGAGGTCTTTGAGAGTGAATATTCACGCAGGAAATATTTCTACATGGCAGGATACCTTCTCCCCGCTGTGGTTGTGGGAGTGTCTGCTGCTGTAGACTTCAGGAGCTACGGGACTAAGAAAGCGTAAGTAAACGTTTCTTTGATTTCCTTTCTTTTTTTTCTGTCTATAGAAGTGTACCACAAATCTTATCGGTTCCATAGGTACGGCACACACACACATAGACACACAGCAAGTCTTCAGAGGCTGCCTTACAGTACAAAATGTGGTTTCCAGGCAGGGCTGCATGCGTTAGTGTCTTTTGTTCAAAGAGTCTCTGGTGACCTGTTGTTTGTAAATGCTCTCTAACGGAGACGAGGGCCGCATGAGAAAGAGGCTTTTACGCAGATTAATGGTAGTGCTTCAGCTCTGCATGGGCTCTTGGGTTGCTCCTTATAACACATAAACAGGTGGAAGTGTGGCAGCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Essential Splice Site 956 1436 13 20
Genomic Location (Zv9):
Chromosome 11 (position 7842696)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7686799
GRCz11 11 7696638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGAGTGTCTGCTGCTGTAGACTTCAGGAGCTACGGGACTAAGAAAGC[G/A]TAAGTAAACGTTTCTTTGATTTCCTTTCTTTTTTTTCTGTCTATAGAAGT
Long Flanking Sequence:
GTTTATTTAACTTTATTTATTTAATTTATTTGTTTTAATTTAAGATAATTTCATTTTATGATTGAAGGAATAAATAGATGAATAAGTTAAAATAAATGAATGAATTAAAATAAACAAACAAACAAACAAACAAACAAACAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAGCAACTTAGAGTATACATTTTTAAACTCAATACAGTTTGCAGTTTATTTGTCTCTGACACTTCTGTCTTTTTTCCTCTCACAGTTGGCCTGCTCCATAATCGCAGGGATACTGCATTACTTCTTTTTGGCGTCCTTTGCCTGGATGTGTCTGGAAGGAGTTCAGCTGTATCTGATGCTGGTGGAGGTCTTTGAGAGTGAATATTCACGCAGGAAATATTTCTACATGGCAGGATACCTTCTCCCCGCTGTGGTTGTGGGAGTGTCTGCTGCTGTAGACTTCAGGAGCTACGGGACTAAGAAAGC[G/A]TAAGTAAACGTTTCTTTGATTTCCTTTCTTTTTTTTCTGTCTATAGAAGTGTACCACAAATCTTATCGGTTCCATAGGTACGGCACACACACACATAGACACACAGCAAGTCTTCAGAGGCTGCCTTACAGTACAAAATGTGGTTTCCAGGCAGGGCTGCATGCGTTAGTGTCTTTTGTTCAAAGAGTCTCTGGTGACCTGTTGTTTGTAAATGCTCTCTAACGGAGACGAGGGCCGCATGAGAAAGAGGCTTTTACGCAGATTAATGGTAGTGCTTCAGCTCTGCATGGGCTCTTGGGTTGCTCCTTATAACACATAAACAGGTGGAAGTGTGGCAGCTTCACGCCACGTCACTGTCTTTTAATATTGAGCACCGAAATCTGCTTTAGGTATGTTTATATTGGTATGAAAGCGATGCGTTTGTCTCAGATGAGTTTACGGTTTGCGAGAGAGCTGCAACATTGACAATTTATATGATCAGTGATTCTTGCTGGAAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21849
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1068 1436 17 20
Genomic Location (Zv9):
Chromosome 11 (position 7866672)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7710775
GRCz11 11 7720614
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTCGCTTGAACAAAAAAAAAAAATGTTCCTTTGAACTGCAGGTACGG[C/T]GAGAGTACAGCAAATGCCTCCGACACACGTACTGCTGTAGCAGGATCACG
Long Flanking Sequence:
GCTCTTTTATTTAAGGATTTTTAGATATTTGGACTAGAAACAAGACAAAAACACAAAGTAAGAAAAGCCCTTTTTGCAGTGTACATGTGCCCAAGATGTTAGTCCAAAACGATTTTCAGGACCCATGTTTGATTTACTATTATTGTAGTACATTTTTGGTTCTTTACTAAATAATACATACATTTTTGTTTCTCTTTTATTTGCTCTCGAAGGTCGTGGGTCATGGGCGGCTTCGCTCTGCTGTGTCTTTTGGGCCTGACCTGGTCATTTGGTTTGTTCTTCATCAGCGAGTCCTCCGTGGTCTTAGCATACCTCTTCACCATTTTCAACACTTTTCAAGGCATGTTTATCTTCACCTTCCACTGCCTCCTTCAAAAGAAAGTAAGTGCTTCCCGGAATACATTGTTCTACCAGAGCAGCAGTCGATTTTAACGAGAAGTGCACATTAAAAAGTTCGCTTGAACAAAAAAAAAAAATGTTCCTTTGAACTGCAGGTACGG[C/T]GAGAGTACAGCAAATGCCTCCGACACACGTACTGCTGTAGCAGGATCACGACAGAGAGCTCGCACAGCTCCACAAAGACCTCAACAACACGGACAAGCGCTCGCTACTCCTCTGGTACTCAGGTACAAATGCTACTGACCCACTTTCCATTGTTTTTCTCTCAATGGCTTTTAATGCAGCGTTCAGTTATATTATGAGGCACATTTTATACTTTGTGAACACTTCCATCTGCTCTTAGCGTGGAGCACAGTCTTTTCATATATGTTTTTTCCTTTTTTGTTGTTTTGTAAAACCGATTTTAGAGGTTTTATTAAACGTCTTTATGATAGATTGTATTATATTATGGGGAATCGTAGCTATAGTTCTTGTACAATGTAAGGATCTGATATACTATAATATATATTATTTTTAAACTATATTACTGTGTGCTCACAAATTATGTAGTATTTATGGTGAAAACTGTGAGATTTTATTATAATTTTTATAGAAGACTTAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1304 1436 20 20
Genomic Location (Zv9):
Chromosome 11 (position 7881176)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7725279
GRCz11 11 7735118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGCACCACACGCATCCCCGCACACTCGAAGCCCCCCTAATCCCCCAG[C/T]GAACTCACTCGCTCCTGTACYACACGCAGGAGAGAGCGAGGCCTGAAGCG
Long Flanking Sequence:
TTGTGAAGTTCTTAATGAGCAGACTAAAGATTTCCAGTGTTTATTCAGCATTCCTATACAGCATTAAACATCTAAAAAAAATGATTGTTTATATTCAGACCAGAACAAACTTAACTCGTTCTTCCTCTTTTGTTGTTGCAGGACACTCGGTGACCAGCGGCAGAGATACGAACACGTTCGGTACTCTACCACTCAACGGCAACTTTAATAACAGCTACTCACTCCATAACTACAGCGACGGCATGCAGGTGGTGGACTGCGGGCTCAGTCTCAACGACACAGCCTTTGAGAAGATGATCATCTCCGAGCTTGTGCACAACAACCTCAGGGCCGCCGAGTCCCGGATCGGTACCAAAAAGGGGGCAGGGATTAGCAGAGGGGAGGAGCCTGTGGTTGCAGAGACGTCCTCCCTGGTGCAGGTGGGCGGTGACAGTGAGATGGAGAGACTGGGGCTGCACCACACGCATCCCCGCACACTCGAAGCCCCCCTAATCCCCCAG[C/T]GAACTCACTCGCTCCTGTACCACACGCAGGAGAGAGCGAGGCCTGAAGCGGAGGCTTCGCATCCCCAGAGCTACATAGGCCAGCTCCCACCTCCGGCCGAAACTGCCCTGCCTTCCCCCAACAGAGACTCGGTGTACACCAGCATGCCAAACCTCAGAGACTCGCCGTTTTCGGAAAGCAGCCTAGACATCGTCCAGGATCTCTCGCCATCCAAAAACAGTCCGAACGAAGACGTTTACTACAAAAGCATGCCCAACCTGGGATCAGGCCAGCAGCTGCACGCGTATTATCAGATGAGCAGAGACAGTAGCGAGGGCCTCATCATCCCCGTCTCTAAAGACGCCTGTGTCCCCGAGGGGGACGTACGAGAGGGACAAATGCAGCTGGTCACAAGCCTTTAAAAACAAACTATAAGCACCGCCCACCATGTACACAGCCCCGCCCATCCACCGATGGCAGAGTGGTCTTCCCTTTTTTAGCCTCCCACATAACTGCACACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4407
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091550 Nonsense 1426 1436 20 20
Genomic Location (Zv9):
Chromosome 11 (position 7881542)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7725645
GRCz11 11 7735484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTCATCATCCCCGTCTCTAAAGACGCCTGTGTCCCCGAGGGGGACGTA[C/T]GAGAGGGACAAATGCAGCTGGTCACAAGCCKTTAAAAACAAACTATAAGC
Long Flanking Sequence:
GGATTAGCAGAGGGGAGGAGCCTGTGGTTGCAGAGACGTCCTCCCTGGTGCAGGTGGGCGGTGACAGTGAGATGGAGAGACTGGGGCTGCACCACACGCATCCCCGCACACTCGAAGCCCCCCTAATCCCCCAGCGAACTCACTCGCTCCTGTACCACACGCAGGAGAGAGCGAGGCCTGAAGCGGAGGCTTCGCATCCCCAGAGCTACATAGGCCAGCTCCCACCTCCGGCCGAAACTGCCCTGCCTTCCCCCAACAGAGACTCGGTGTACACCAGCATGCCAAACCTCAGAGACTCGCCGTTTTCGGAAAGCAGCCTAGACATCGTCCAGGATCTCTCGCCATCCAAAAACAGTCCGAACGAAGACGTTTACTACAAAAGCATGCCCAACCTGGGATCAGGCCAGCAGCTGCACGCGTATTATCAGATGAGCAGAGACAGTAGCGAGGGCCTCATCATCCCCGTCTCTAAAGACGCCTGTGTCCCCGAGGGGGACGTA[C/T]GAGAGGGACAAATGCAGCTGGTCACAAGCCTTTAAAAACAAACTATAAGCACCGCCCACCATGTACACAGCCCCGCCCATCCACCGATGGCAGAGTGGTCTTCCCTTTTTTAGCCTCCCACATAACTGCACACATAATGGAGAAGTACCGCTGCTGCTCAATGAGTTACATTCAGGCCCAGATGGAATCTGCAGACTTATTGCGTTAGCTCTCCTGATTGTTAGCAGTGGAATGAAAATGATGGTAAAACACAAAGCTTTTCCCTTGTTTTTCAGTAAAAAAACGTCTACACCTCCTTTAAACAAGTTTACTTGAGCAGTCATTTAAGAAACATTTCAATACTTTCTCAAAGCAAAGACGCTGTTTCTCAAACAAATATGCTTTCCTGGAAAACAAGGAAGAATAATAGGATCATTTTCATTTGTTTTGGTTGCTGAGTGTAATCAAAAATCTAATTAGCCACAGTTATTTAATAAATACACATACAAGAGTCAGATTAT
Associated Phenotype:
Not determined