Busch Lab

ZMP

mus81

Ensembl ID:
ENSDARG00000069326
ZFIN ID:
ZDB-GENE-040426-2923
Description:
Crossover junction endonuclease MUS81 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXA9]
Human Orthologue:
MUS81
Human Description:
MUS81 endonuclease homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29814]
Mouse Orthologue:
Mus81
Mouse Description:
MUS81 endonuclease homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918961]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34036 Nonsense Available for shipment Available now
sa16723 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34036
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100779 Nonsense 25 603 2 18
ENSDART00000100782 Nonsense 25 612 2 17
ENSDART00000142970 Nonsense 25 137 1 4

The following transcripts of ENSDARG00000069326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21009161)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19599597
GRCz11 7 19851565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGGAAGCGCCCTCTGCCATCGTGCCCCAATCCTCTGTTTCTGCAGTG[G/A]TTGACGGAATTACGGGACAGCGCCAAGGAGAAGGGCTTGAAGACTCAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26926
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100779 Nonsense 68 603 3 18
ENSDART00000100782 Nonsense 68 612 3 17
ENSDART00000142970 Nonsense 68 137 2 4

The following transcripts of ENSDARG00000069326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21009384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19599820
GRCz11 7 19851788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAAAATATCCTCTTCCTCTGAAAAACGGGAAGGAGGCGAAGATCCTG[C/T]AGAACTTCGGCGACGGGATCTGCAAGATTTTGGACGAGCGCCTGCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100779 Nonsense 593 603 18 18
ENSDART00000100782 Nonsense 602 612 17 17
ENSDART00000142970 None None 137 None 4

The following transcripts of ENSDARG00000069326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21037703)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19628139
GRCz11 7 19880107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTTATTTGTYTGTAGGAATCTTGGACCAGCATTAAGCCKCACGATATA[T/G]YAGCTTTACTGTACTCGTGGACCTTTGTCATAGGATTTTACATTGCTAAA
Associated Phenotype:
Not determined