Busch Lab

ZMP

efr3bb

Ensembl ID:
ENSDARG00000069318
ZFIN ID:
ZDB-GENE-041014-293
Description:
Protein EFR3 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q5SPP5]
Human Orthologue:
EFR3B
Human Description:
EFR3 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:29155]
Mouse Orthologue:
Efr3b
Mouse Description:
EFR3 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2444851]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43518 Nonsense Mutation detected in F1 DNA Not yet available
sa37134 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29442
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100761 Essential Splice Site 3 816 None 23
ENSDART00000134855 Essential Splice Site 3 816 None 24
Genomic Location (Zv9):
Chromosome 20 (position 42923273)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42994432
GRCz11 20 42891510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGTAGCCGGTTGAGTGCGACATCTGGCGTTGGAAGTCATCATGACAGG[T/A]AAGAACTGCAAGAAATCTACACTACTTCATATACAGGGTTTTAGTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43518
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100761 Nonsense 42 816 3 23
ENSDART00000134855 Nonsense 42 816 4 24
Genomic Location (Zv9):
Chromosome 20 (position 42951348)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43022507
GRCz11 20 42919585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTACAGGATGGCTTGGTCAAGGCCAACATGGAGAAACTGACTTTCTA[T/A]GCCCTGTCAGCTCCAGAGAAGCTGGATCGGATCGGGGCATACCTGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100761 Nonsense 72 816 4 23
ENSDART00000134855 Nonsense 72 816 5 24
Genomic Location (Zv9):
Chromosome 20 (position 42951543)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43022702
GRCz11 20 42919780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCACTCTTGATACTTCCTGTATTGAGTGTGTGTTTGTCTTTTCAGGTA[T/A]GTGTGTATTGCGATGGAAGCTCTTGACCAGCTTCTAATGGCCTGCCACTG
Associated Phenotype:
Not determined