Busch Lab

ZMP

snx9l

Ensembl ID:
ENSDARG00000069302
ZFIN ID:
ZDB-GENE-031118-50
Description:
sorting nexin-9 [Source:RefSeq peptide;Acc:NP_001025295]
Human Orthologue:
SNX9
Human Description:
sorting nexin 9 [Source:HGNC Symbol;Acc:14973]
Mouse Orthologue:
Snx9
Mouse Description:
sorting nexin 9 Gene [Source:MGI Symbol;Acc:MGI:1913866]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16301 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29443
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060938 Nonsense 68 608 4 19
ENSDART00000060982 Nonsense 68 581 4 18
Genomic Location (Zv9):
Chromosome 20 (position 43093937)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43165096
GRCz11 20 43062174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTCTTTTTATTTTCTTCTAGATTAACCAGGCTCAGCCTTTAACCTCT[G/T]GAGGAAATGCAGCCCCCCTCGATCTCTCATTTTTTGACAGTCACGTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16301
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060938 Nonsense 470 608 15 19
ENSDART00000060982 Nonsense 443 581 14 18
Genomic Location (Zv9):
Chromosome 20 (position 43061176)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43132335
GRCz11 20 43029413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGTRTGTTTGTATAATTCTGAATATATATGGTTTTATTGATCTACAGGA[G/T]AAGGAACACTCACCGATGCAATGACTGCKGCAGGAAAAACCTATGAAGAG
Associated Phenotype:
Not determined