Busch Lab

ZMP

upf3a

Ensembl ID:
ENSDARG00000069297
ZFIN ID:
ZDB-GENE-060721-2
Description:
Regulator of nonsense transcripts 3A [Source:UniProtKB/Swiss-Prot;Acc:B0S733]
Human Orthologue:
UPF3A
Human Description:
UPF3 regulator of nonsense transcripts homolog A (yeast) [Source:HGNC Symbol;Acc:20332]
Mouse Orthologue:
Upf3a
Mouse Description:
UPF3 regulator of nonsense transcripts homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914281]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18954 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11009 Essential Splice Site Available for shipment Available now
sa21535 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18954
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35884353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35103864
GRCz11 9 34913049
KASP Assay ID:
2260-2134.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTGTTTATATAGAAATACTATGATCATGAGTGCTGTCAGT
Long Flanking Sequence:
CTACATAAAATGAATAAAATGTAAAAAGTTTTTACACTCACAAAAAATTCTTACATGCCTGTCTGTTTTTTAATAACTAATAAGGTTTCAGTGATATTTTCATATCTGAACAAGAATATTTTTGTTTTTATCTTAAAAATTTGATAATTTTATTTTTAAAAAGTGGTCAGTTTTGTAAACCAGAAATATTATAATTATTTGTTACATATGTCCTGTTGTTAAATAAAATAATAATAATAATAATAATAATAATGCATTATTATTATTACCATATTATCATTATGAAATACTTTATAGTTCATTGATAATATAGTAATATTTCTTCATTTTTTAATAACTTGAATAAGCTTGTTTTCAGTATTATCAGACTTCTTTTATTCTTCTTTTATATAGGTTGTCATCCGCCGACTGCCACCCAGTCTATCAAAAGACCAGCTCCAGGAGCATCTGAGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTGTTTATATAGAAATACTATGATCATGAGTGCTGTCAGTGTAATTTACATGTGCATATTTGATATATTTTTATTCTCCCCAGCTTATACCCTCATCTCTTCTCAAGAGCATACATAAACTTCAAAAACCCAGAGGATATCATAATATTCAGAGATCGCTTTGATGGCTATGTATTTATTGACAATAAAGGTGATTTGCTTTCTGCTTTTTTTCTATGTATCCTCATTGAATCTAATATTTTCTGACTATAACTTTAGGATATTTACTTTTTATTATGACATATGATATAATAGATTAGTATAACATTTATTTTACTTCTGTTTATTTAGGTCAAGAATATCCAGCTGTTGTAGAATTTGCCCCATTTCAGAAGGTTTCCAAGAAAAAGCTAAAGAAGAAAGATGCGAAAGCTGGGACCATTGAAGAAGGCATCTTAAAAAAGATTTCTTAATATTTATAATTTTGAAGTATTCAAGAATTGACGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11009
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35884353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35103864
GRCz11 9 34913049
KASP Assay ID:
2260-2134.1 (used for ordering genotyping assays)
KASP Sequence:
AGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTSTTTATATAGAAATACTATGATCATGAGTGCTGTCAGT
Long Flanking Sequence:
CTACATAAAATGAATAAAATGTAAAAAGTTTTTACACTCACAAAAAATTCTTACATGCCTGTCTGTTTTTTAATAACTAATAAGGTTTCAGTGATATTTTCATATCTGAACAAGAATATTTTTGTTTTTATCTTAAAAATTTGATAATTTTATTTTTAAAAAGTGGTCAGTTTTGTAAACCAGAAATATTATAATTATTTGTTACATATGTCCTGTTGTTAAATAAAATAATAATAATAATAATAATAATAATGCATTATTATTATTACCATATTATCATTATGAAATACTTTATAGTTCATTGATAATATAGTAATATTTCTTCATTTTTTAATAACTTGAATAAGCTTGTTTTCAGTATTATCAGACTTCTTTTATTCTTCTTTTATATAGGTTGTCATCCGCCGACTGCCACCCAGTCTATCAAAAGACCAGCTCCAGGAGCATCTGAGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTGTTTATATAGAAATACTATGATCATGAGTGCTGTCAGTGTAATTTACATGTGCATATTTGATATATTTTTATTCTCCCCAGCTTATACCCTCATCTCTTCTCAAGAGCATACATAAACTTCAAAAACCCAGAGGATATCATAATATTCAGAGATCGCTTTGATGGCTATGTATTTATTGACAATAAAGGTGATTTGCTTTCTGCTTTTTTTCTATGTATCCTCATTGAATCTAATATTTTCTGACTATAACTTTAGGATATTTACTTTTTATTATGACATATGATATAATAGATTAGTATAACATTTATTTTACTTCTGTTTATTTAGGTCAAGAATATCCAGCTGTTGTAGAATTTGCCCCATTTCAGAAGGTTTCCAAGAAAAAGCTAAAGAAGAAAGATGCGAAAGCTGGGACCATTGAAGAAGGCATCTTAAAAAAGATTTCTTAATATTTATAATTTTGAAGTATTCAAGAATTGACGTCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27440
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Nonsense 129 452 4 10
ENSDART00000123005 Nonsense 129 427 4 11
ENSDART00000139608 Nonsense 129 478 4 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35883974)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35103485
GRCz11 9 34912670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTTATTTAGGTCAAGAATATCCAGCTGTTGTAGAATTTGCCCCATTT[C/T]AGAAGGTTTCCAAGAAAAAGCTAAAGAAGAAAGATGCGAAAGCTGGGACC
Long Flanking Sequence:
CTTCTTTTATATAGGTTGTCATCCGCCGACTGCCACCCAGTCTATCAAAAGACCAGCTCCAGGAGCATCTGAGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAGGTATGTCCACTTTGTTTATATAGAAATACTATGATCATGAGTGCTGTCAGTGTAATTTACATGTGCATATTTGATATATTTTTATTCTCCCCAGCTTATACCCTCATCTCTTCTCAAGAGCATACATAAACTTCAAAAACCCAGAGGATATCATAATATTCAGAGATCGCTTTGATGGCTATGTATTTATTGACAATAAAGGTGATTTGCTTTCTGCTTTTTTTCTATGTATCCTCATTGAATCTAATATTTTCTGACTATAACTTTAGGATATTTACTTTTTATTATGACATATGATATAATAGATTAGTATAACATTTATTTTACTTCTGTTTATTTAGGTCAAGAATATCCAGCTGTTGTAGAATTTGCCCCATTT[C/T]AGAAGGTTTCCAAGAAAAAGCTAAAGAAGAAAGATGCGAAAGCTGGGACCATTGAAGAAGGCATCTTAAAAAAGATTTCTTAATATTTATAATTTTGAAGTATTCAAGAATTGACGTCATTGTGTAAATTACAGTTGATGTCAGAATTAACAACCCCCTTCAAATTTTTTTCTTCTTTTTGAAATATTTTCCAAATTATGTTTAACAGAGCAAGGGAGTTTTCTCAGTATGTCTGATAATATTTTTTCTTCTGGAAAAAGTTTTTTTTTATTTAGTCTAGAATAAAAGCAGTTTGAATTTTTTTAAACACCATTTTAGGGACAAAATTATTAGCCCTTTTAAGCTATTTTTTTTCTTGAAAATCTACAGAACAAAGCATTGTTATACAATAACTTGCCTAATTACCCTAACTCACCTAGTTACCCCAATTAACCTAGTTAAACCTTTAAATGTCCCTTTAAACTGTATAGAAGTGTCTTGAAAAATATCTAGTAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21535
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 302 452 8 10
ENSDART00000123005 Essential Splice Site 277 427 9 11
ENSDART00000139608 Essential Splice Site 302 478 8 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35879754)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35099265
GRCz11 9 34908450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGGAAAAGCCTGGAGGACACACTAAGTCAAAGGATTCAAAGGATAAG[T/G]AAGAGCTTCCTAAAACTTACCCCTTCTTGAAAAGATATGAGTTAAAAATA
Long Flanking Sequence:
GAAATTAGAGAAACAGGTAAGAGCACCATATCACTGCATATAACACACTGCGGTTTTGTGCTGTATGTACATCACCATGCCTTTCCATTCTAGAGAATAAGAGAAGAAAAAAGAGAAGAGAGGCGAAGAAGAGAACTGGAAAAGAAGAGGCAGAGGGAAGAGGAGAAGAGGAAACGCAGAGAAGAGGAGAGACAAAAGCGGAAGGAGGCAGAAAAGCAGAAAAAGCTCTCTGAGAAAGAGATAAAGATCAAGGTACGAGTTTAATACCATATTACATCCCATTGCTCGACTGTGCTTATCAGTACTGTAAAACACACACAAACACACGCAGTCATAACATCAGATTTGCATGTTGACTGCTTTAGCTTTTGAAGAAGTGTGACCGAGACGATGACGTGGATTCAGACAGACTGAAAGATAAAGGAGACAGTGGAGAGACGGAGAAGAACAGATGGGAAAAGCCTGGAGGACACACTAAGTCAAAGGATTCAAAGGATAAG[T/G]AAGAGCTTCCTAAAACTTACCCCTTCTTGAAAAGATATGAGTTAAAAATAGAGTTAAAGAGTTAAAAATAGAGTTTAAAAATTAAGGATTCAGATTTGTAAATCAACCAAAAGTTGAAAGTTGGGATGAAATTTTCCATTTTCTTAATAACTTTTTAAAGGGATGGATTTACTCGACCAGAAATAAAGATAATTTAAATAATATTTGTAACAGATTTCCAACATTGTTTGAATTATTTTCTTTTGTGTTCAACTGATGACATTCTATGTGGGTGATTAATTTTGTGTGGACTGCCCCCTTATTCATACTTTCCTAATTTTATCTTGTTAATTTCAATGGAAATGTCATAACTTTACTTTCTCTATTTTCCACAAGTGGAATTTTATTTTTGGCTTCACCACACAACCACATCAGCGTTCATATTACACATATCATAGAAAAACAGGCAACACAAATACATTCAGTGTCATCACATAAATCACATTAAAAACTCAATTAAC
Associated Phenotype:
Not determined