Busch Lab

ZMP

si:ch73-252g14.4

Ensembl ID:
ENSDARG00000069293
ZFIN ID:
ZDB-GENE-030131-1133
Description:
si:ch73-252g14.4 [Source:RefSeq peptide;Acc:NP_001093499]
Human Orthologue:
AHSG
Human Description:
alpha-2-HS-glycoprotein [Source:HGNC Symbol;Acc:349]
Mouse Orthologue:
Ahsg
Mouse Description:
alpha-2-HS-glycoprotein Gene [Source:MGI Symbol;Acc:MGI:107189]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8596 Nonsense Mutation detected in F1 DNA Not yet available
sa1801 Missense F2 line generated Not yet available
sa19684 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8596
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Nonsense 64 386 1 7
Genomic Location (Zv9):
Chromosome 2 (position 9923532)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10336815
GRCz11 2 10134635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATAACRGGTTCCTGGGCGCAGGGGGTACAGACCACYGTCAACTTGGCT[G/T]AATGTGATTCTCCAGAGGCTGAAGCAGCAGCTCTTGCAGCACAAGATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1801
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Missense 161 386 3 7
Genomic Location (Zv9):
Chromosome 2 (position 9924943)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10338226
GRCz11 2 10136046
KASP Assay ID:
554-1793.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGATTGTGATTTTGCTGTGACTAAAGGCCTGTCMATTGTGGCATTCAA[G/T]TGTAAAACTGAGATTGGTAAGAAGAAACAAAACAAAAACCAAACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19684
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Essential Splice Site 218 386 4 7
Genomic Location (Zv9):
Chromosome 2 (position 9925293)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10338576
GRCz11 2 10136396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTAAAGACAAAGTTTGCACTCTTTGAAATTGGACGAATGACATCTCAG[G/A]TAGGATAATAAATGAAAATAATGTATTGAAATAATAAATAAATCTCATTA
Associated Phenotype:
Not determined