Busch Lab

ZMP

si:ch211-206k20.4

Ensembl ID:
ENSDARG00000069269
ZFIN ID:
ZDB-GENE-060810-148
Description:
WD repeat-containing protein 35 [Source:RefSeq peptide;Acc:NP_001139061]
Human Orthologue:
WDR35
Human Description:
WD repeat domain 35 [Source:HGNC Symbol;Acc:29250]
Mouse Orthologue:
Wdr35
Mouse Description:
WD repeat domain 35 Gene [Source:MGI Symbol;Acc:MGI:1921932]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22338 Essential Splice Site Available for shipment Available now
sa42238 Nonsense Mutation detected in F1 DNA Not yet available
sa14117 Essential Splice Site Available for shipment Available now
sa35532 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Essential Splice Site 146 1203 5 29
ENSDART00000140099 None None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32847569)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32493517
GRCz11 13 32623967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGCATTGTGTATGAGGACGGTGCTGTGATTGTGGGCTCAGTGGATGG[T/C]AAACATTAATATAATCTTACTAATAGCAATACTATATATTTTTTTCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Nonsense 472 1203 14 29
ENSDART00000140099 None None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32841834)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32487782
GRCz11 13 32618232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGACAAAGACACACGTGATTGCTGCTTCTCGGGAGGCATTTTACATTT[G/A]GCAGTATCGTGTTGCAAAAAAACTCACCGCTCTTGAAATCAACCAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14117
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Essential Splice Site 539 1203 None 29
ENSDART00000140099 None None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32825953)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32471901
GRCz11 13 32602351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGATCCGATCTGCTGCATCACAGCATCAGACAAGATGCTCCTWGTGG[T/C]ATGTCYGATTTACGCAAGCACAYACTTTTACATCCCAAAGCTTCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35532
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Nonsense 619 1203 18 29
ENSDART00000140099 None None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32825489)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32471437
GRCz11 13 32601887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCGGGTCTACAGCTGGAGACCCATCTAAATTTGAGCGCAAGGATGTCT[G/A]GGATATGAAATGGGCCAATGACAACCCAGATCTGTTCTCCATGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28146
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Nonsense 1030 1203 27 29
ENSDART00000140099 None None 213 7 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32812192)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32458140
GRCz11 13 32588590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTCTGTGTGTGATTTATTTCAGGCTACCAGTGCATTAGCAGGACTGT[T/A]AGAGGAAGATGAGTCGTCTTCAGACAGTCGTATCCTGGATGACGCCTGGC
Associated Phenotype:
Not determined