Busch Lab

ZMP

si:ch73-131e21.7

Ensembl ID:
ENSDARG00000069249
ZFIN ID:
ZDB-GENE-030131-1437
Description:
aftiphilin [Source:RefSeq peptide;Acc:NP_001139033]
Human Orthologue:
AFTPH
Human Description:
aftiphilin [Source:HGNC Symbol;Acc:25951]
Mouse Orthologue:
Aftph
Mouse Description:
aftiphilin Gene [Source:MGI Symbol;Acc:MGI:1923012]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7414 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18714
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100630 Missense 184 793 1 9
ENSDART00000100631 Missense 184 390 2 2
ENSDART00000127068 Essential Splice Site 91 537 None 11
ENSDART00000132727 Missense 184 793 2 10
Genomic Location (Zv9):
Chromosome 1 (position 55638865)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54421886
GRCz11 1 55099537
KASP Assay ID:
2259-1234.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGATCACGACCAGCCTTCAAATACAGACTGGGAGCTTTCCAATCAAG[G/A]GTGTAGAGTGGCTCAGAACGACGTTAGCGACAGTGTTGAACTTTCCAATC
Long Flanking Sequence:
GGACGCTGGCGAGGACGAGGAGGACGAATTCAGCGACTTCACCGGCGTCCCGAACAGCACCAGCTTCTCAGAGTTCGACACGCCGACCACCTTCAACCAATCTCAGGCCCTGAACGCCACCTCGCCACCAGAGCTGCTGAGCAATGGACGGATCGTGGGTCTGTCTTCGCAATCCGCAGGGTCTACCAAGGCTAACGGCGTTGCACCTGGCGGGGGCCAGACTGGCATGCCAAATGGCAGAACGGTTAGTGTTGAGGAACTCAAAAAGCTGACCGAGCATCAAGCTCACATCACATCCCTGGAGTTTCCCACCAGCTCTCGAACTGACAATGACTGCAATGGCACTGTTGAAGTGCTTACGAACGGGTTTGCAAGCTTGGAGCAAGCATCAACGCCACACAAAAACAACGAATCTGACGACGATTTTGCAGATTTTTCTGCTTTTTCAAATGCTGATCACGACCAGCCTTCAAATACAGACTGGGAGCTTTCCAATCAAG[G/A]GTGTAGAGTGGCTCAGAACGACGTTAGCGACAGTGTTGAACTTTCCAATCAAGGGAGTAGATTAGCTCAGAATGACGTTAGCGGAGAGTGTGAAGATAGTATAGAAGCGGTTTCAAAAATCACAGGGTTTGAACTCCCTTCAGAAAGCTCTGAAGGTCTCAGCAATGGGGACTTGGGTTTTCATGAGGGATCAGATTTAGATCAAAGAGATCTAGAAACTAATACTACTGAATACGTTAGCACATCGCTAACTCTTAACGGCGTTGCTCGAAGCGAGAGCGATGACAATAGCGTGTCACCTAATGGTGAGAGATGTAGCGGAGGACAATCAGACGAGAAAGGCTCTGAGACTGAAGAAACCGAAACTGAGACCTCCTTCGGTCGGCCGCTGTCCACAGAGGCGCTCGAAGAGTTCGGCGACTTTAGCACGACGGGATCCGTACCATCACCTCCTCTTCAGGAGGAGACCGCCACACCTGCTGACCACAGCCAGCTAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7414
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100630 Missense 403 793 1 9
ENSDART00000100631 None None 390 None 2
ENSDART00000127068 Missense 157 537 2 11
ENSDART00000132727 Missense 403 793 2 10
Genomic Location (Zv9):
Chromosome 1 (position 55639523)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54422544
GRCz11 1 55100195
KASP Assay ID:
554-4339.1 (used for ordering genotyping assays)
KASP Sequence:
ACTCWGCCTGAAGCGGCCGCAGAGAAAACTGAAGATGACGAATTTGRTGA[T/A]TTTGACACATCAAAAGAATTTAGTAAAACGGATTTGCCAGCTGAGGAGGC
Long Flanking Sequence:
CTCAGCAATGGGGACTTGGGTTTTCATGAGGGATCAGATTTAGATCAAAGAGATCTAGAAACTAATACTACTGAATACGTTAGCACATCGCTAACTCTTAACGGCGTTGCTCGAAGCGAGAGCGATGACAATAGCGTGTCACCTAATGGTGAGAGATGTAGCGGAGGACAATCAGACGAGAAAGGCTCTGAGACTGAAGAAACCGAAACTGAGACCTCCTTCGGTCGGCCGCTGTCCACAGAGGCGCTCGAAGAGTTCGGCGACTTTAGCACGACGGGATCCGTACCATCACCTCCTCTTCAGGAGGAGACCGCCACACCTGCTGACCACAGCCAGCTAGTCGAGGACGACGACGAGGATTTCGGAGACTTCGGAGACTTTGGAGATGCCAACGCATTTAGTGCAGGTGGTTTTGCAGATTTTGACCAGCAGGGGGCGGAGACGCAAGTCACTCAGCCTGAAGCGGCCGCAGAGAAAACTGAAGATGACGAATTTGGTGA[T/A]TTTGACACATCAAAAGAATTTAGTAAAACGGATTTGCCAGCTGAGGAGGCCACAACGTCTGCGGACTTTCCTGGAAGTGACAGTTTTGCGGATTTTAGCTCCGCACAGGGGAACGATGGCGCCGATGACGGAGGTTGGCAAGCGTTTTCTGAGCCGGATCAGAGCCAAAATGGAGAGGAATCGTGGGCAACATTTGAGCAGGCGCAGGATGGAGCATGTGCTCAAATGAGTGGAGATAAATGGCAGCCTGACACAGCACCTCCTACTGGTGTGGAGGAGCGCAAAAGTTGCACAACGGTAAGCCTCAATGCGGATAACATTGAAAATTGGCGGTTTGTCATTGCAGTTTTTCTCCCAACCCCATGCTGTTATCTTTTCCTGAATGTTCAAAGGTATTGAGAATCTGGCAGGAATGTCTACAGGAAATTAAATCAGATTGAGGAATGTGTCCGGATTGGATGGTTTACTCTGTCTACATGGTTGATTGAGCAAAAACACAG
Associated Phenotype:
Not determined