Busch Lab

ZMP

si:ch211-244b2.2

Ensembl ID:
ENSDARG00000069244
ZFIN IDs:
ZDB-GENE-030131-4737, ZDB-GENE-050208-562
Description:
hypothetical protein LOC557230 [Source:RefSeq peptide;Acc:NP_001076279]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14692
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100611 Nonsense 285 347 11 13
Genomic Location (Zv9):
Chromosome 4 (position 25172463)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26096132
GRCz11 4 26085330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACAAGCTCGCTGGCAGTTTAAAGACATGGAYGGCAAATGGAAGGATTA[T/A]GTGAGAGTAAATGARCATTTACTAAACTTTCTCCAAATNTATTGTTAAAC
Long Flanking Sequence:
ATAATATGTAGAAGTCTCTTGTGTTCTGCAAGCCTGACTAATAAACAGGGTTTTTATTATGAAATGTCGAACTAGAGAACGTCTGATAAGAAGAAAGGAGGGTTAAAGGTTGAAACTTTAAGGCCTTGACTGTGTTTGGAAAGGAATGCAAACACACAGGTACTGCATATGTCATAACTGTATTGTTGAAATGTATATCTACAGGAATGTATCAAGTAAACGATAGACTTGGTACAAGAAGAACAGTCAGAAGGATCGCCAGTGGAAGCCAGCAGACAAACAAGTATGAGTGAATTAATGAAAGATATACAAATTAATTATATATATATATATATCCCATTTGTATACAAAATATATACAAACTTCCATTTGTTATTTTACATCTTAAAATTCAGTCTAGGAAAAATATCTGAGTATGTTTTATATGTGTGTGTTTTTTACAGTGCATTGTCACAAGCTCGCTGGCAGTTTAAAGACATGGATGGCAAATGGAAGGATTA[T/A]GTGAGAGTAAATGAGCATTTACTAAACTTTCTCCAAATGTATTGTTAAACAGTCATGTAATGTAACAGTGTAATGTAACAGTCATGTTATGCTCTAACATGATGTAGATTAAAAAAAAACAGTGCCAAAAAGGCAGCAGTTAAAATGAAAGGATGCTGTTACTTTGAATGAATTAGTAAGTTACAGCTGAACAAAGTACATGTTAGATTCAATTAAACGGTCATAAATAAATAAATAAATAAATAAACACAGACTTCAAAGTGTTTTTTTATGACCCTTTAATTGAATCTAACATGTATTGTTCAGCAGTAACTTGCTAATCCTTATAGTTAAGGTGATTAGGTGGTTAAGGTTTTAGTGTTTTGAGTTTTTGGGGTTTTATTTATTTATTTATGTTAATAAAAATGTATGTCTATTGTGTATATTTATGTATATATATTTCTCAGCATAACTGAGTACACCCCATTTTGAAAATTAATATTTTTTTTTCCATTTATCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26310
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100611 Nonsense 347 347 13 13
Genomic Location (Zv9):
Chromosome 4 (position 25170264)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26093933
GRCz11 4 26083131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGACCAACCTGAGGACTAACACGAGGAGAGCCGTACAACGCCTTCAG[C/T]AATAGGACTGTTTACTTTTACTGTAGCAGTGTATGAATAATCTCAGGATG
Long Flanking Sequence:
TGTCAAGTCAAGATATTGAAGCTCAGTATCAGCAAGACCCCACTGCCATCATGAGCTTCAGTGCAGGCAGATTCAACTATGAGCTCGACTTCTCAGGTGCGTGCATGAAGAAAAAAAAACATGAATTATTTATAAACATTATTTATGCATATATATCTTATACCAATTCGTAACTTTTTGATTTAGTGGCTAATTTGTATGAATTTTCGATCTCATTTGTACATTTTAGCATTATTTGATCATCCCCCAATAATGGGTTTAGGAGTGGAGTTTGGTGCCTCACCTTCTTTTTTAAAATCATACTTTTTCATACGACTGATTGGAGTTTGTACAAATTAATAGCCACTTAAGTAGCAAAAAAAAGAAGCTACGTTTCCTTGTAAAATCTGGCTGAAAATACAAGTTCTTTCGCATAAATGATGCTTAAATCAATTGTTTTTGCAGCCATGACTCAGACCAACCTGAGGACTAACACGAGGAGAGCCGTACAACGCCTTCAG[C/T]AATAGGACTGTTTACTTTTACTGTAGCAGTGTATGAATAATCTCAGGATGCCGGTTTATGCTATGTTTGCTGGCCATGACTAATATATGTTGATATGATGTTTTTTTTCATAGAAATTATGTAGTTTTTCAATGCTAACTTGTGTCACATGATTTATCAACTGCCATAAATTCATGATCATTGAATGTACTATTTGTTTTCAGTTTTCAGCTTTTCTTTTCGGTGCATTTACTGTGATTAGAAAACAAAATGATATAATGTGTGGTTTTTCTTTTTTCTTTGTTAACTGCCAATTAAAATTATGAGGAAAATTTTATTAAAATTTTATTTAGAGAAGTCTGTTTACATTATTTATGCTAATCCCTAATGTTCAAAGGGTTCTGACATGTTGTTGGTCAATAAATTTCCCTCGACTTTTCCATGACTTCAATTCTGATTAGAATTACTGATTTTCTTTCTCTATTAAACTGACATTACTCTTCTAATTTATATTCGCATTT
Associated Phenotype:
Not determined