Busch Lab

ZMP

ETV6

Ensembl ID:
ENSDARG00000069193
Description:
ets variant 6 [Source:HGNC Symbol;Acc:3495]
Human Orthologue:
ETV6
Human Description:
ets variant 6 [Source:HGNC Symbol;Acc:3495]
Mouse Orthologue:
Etv6
Mouse Description:
ets variant gene 6 (TEL oncogene) Gene [Source:MGI Symbol;Acc:MGI:109336]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39394 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4239
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100501 Essential Splice Site 12 206 1 5
Genomic Location (Zv9):
Chromosome 23 (position 5241622)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5191757
GRCz11 23 5101620
KASP Assay ID:
2261-7298.1 (used for ordering genotyping assays)
KASP Sequence:
CAAGGTTAAAGAACATGAGTGACGCCTCTTCACCGCCACCTTTAATAAAG[G/A]TAAGTYMTCTGGTAGATACACAACAAGCTTACTGGGAAAGTACAGTATGY
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29869
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100501 Nonsense 53 206 2 5
Genomic Location (Zv9):
Chromosome 23 (position 5239925)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5193597
GRCz11 23 5099780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCTCCGTGTCTGAGGCAGTGCCTGAAGAACTGTGCAAACTGCCAGGA[C/T]GATTACGTACGTTCCTTCTAAACAAAACTCTAATGTGATCACATTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39394
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100501 Nonsense 154 206 5 5
Genomic Location (Zv9):
Chromosome 23 (position 5234917)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACAGCAATAATTGGTTTTGCAGGTCCTTATGTTCCCTCTAACAGATG[T/A]GTTCCTGTTTGTCCTGTGAACCCAAATTCTCGGGCGGTTTCAGCTGGATG
Associated Phenotype:
Not determined