Busch Lab

ZMP

si:dkeyp-68f9.10

Ensembl ID:
ENSDARG00000069186
ZFIN ID:
ZDB-GENE-081104-511
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6152 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa14111 Nonsense Available for shipment Available now
sa27447 Nonsense Mutation detected in F1 DNA Not yet available
sa21546 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6152
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 Essential Splice Site 74 438 1 8
ENSDART00000135748 Missense 75 522 1 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472576)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610472
GRCz11 9 38420267
KASP Assay ID:
554-3659.1 (used for ordering genotyping assays)
KASP Sequence:
AAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGKTACCTCAACAGC[G/A]TACATGAGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTRTCAT
Long Flanking Sequence:
CGTTTTTGTTCTCCGCTACATGTGCTATTTGTTCTTTTTTTGACACCAAAGTTCAACTTTTGTGCTCCAGAAAAGAAAAAGATGAATATGGACAATTATTGTAAATGTCTAATGTTTAACTTAACGTTATTATCAATTATAATACCATATGTCACATTTTCAAACTCCTCAAGCTATATTATTACAACAGATAGTGAAGGGTTAAATAGTGAGTCTTTTTGTCCAGCCCTCCCTCTCATTCCGGTGTCGTTAACCTCATTTTTCTTTCTAAGTCCATAATGGCTGTTTGTTTTGCTTTGAGCTCTGCAGAAAGGCTCGGATGGTGTTTTCTGAGACCCACGGCAGCGGCCACAGGCTTCAGGAGTGCAGCAGGAAATGCTGCGGCTGCTTCTGTCAGTGTCCAGGACGGCCACAGAAAGCTGAAGACTGAGGCTGACCTTCCAGAGATCAAAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGTTACCTCAACAGC[G/A]TACATGAGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTGTCATGTGATTTTATCTGCAGGACTCTTGACATTATTGTTATTGTTTATGTCCTGATGCTGTCAGGTGTTTTAATGAATTGAAAAGAAACGGCTGTCATTTTATCTCTCCAGTTATATCAAAAACAGGTTTATGGCCCCTTGTGGAAAATTAATGCTGGAAACCTCCAAGGCATTTCAATAAGCAGTGTGGAGCTGCTGGAAGAACTCCTTCGAAAAGATGAGAAATATCCATGCAGAGGATACATGACTCTGTGGACAGAGCACCGGGACTTAAGAGGCATTAGCTATGGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTTTACAGCCCATTTAAAAAGCAAGTTGGCAAAGTTGGCTAATGTAGCTGTTTCGTGTTATACAAAATCATGAACTCGGTAACACTTTACAATAGGTTCATTAGTTAATGCATTTGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27446
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 Splice Site None 438 None 8
ENSDART00000135748 Nonsense 77 522 1 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610478
GRCz11 9 38420273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACCATGTTGTATCAAATGCTCTTCAAAGGTTACCTCAACAGCGTACAT[G/T]AGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTGTCATGTGATT
Long Flanking Sequence:
TGTTCTCCGCTACATGTGCTATTTGTTCTTTTTTTGACACCAAAGTTCAACTTTTGTGCTCCAGAAAAGAAAAAGATGAATATGGACAATTATTGTAAATGTCTAATGTTTAACTTAACGTTATTATCAATTATAATACCATATGTCACATTTTCAAACTCCTCAAGCTATATTATTACAACAGATAGTGAAGGGTTAAATAGTGAGTCTTTTTGTCCAGCCCTCCCTCTCATTCCGGTGTCGTTAACCTCATTTTTCTTTCTAAGTCCATAATGGCTGTTTGTTTTGCTTTGAGCTCTGCAGAAAGGCTCGGATGGTGTTTTCTGAGACCCACGGCAGCGGCCACAGGCTTCAGGAGTGCAGCAGGAAATGCTGCGGCTGCTTCTGTCAGTGTCCAGGACGGCCACAGAAAGCTGAAGACTGAGGCTGACCTTCCAGAGATCAAAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGTTACCTCAACAGCGTACAT[G/T]AGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTGTCATGTGATTTTATCTGCAGGACTCTTGACATTATTGTTATTGTTTATGTCCTGATGCTGTCAGGTGTTTTAATGAATTGAAAAGAAACGGCTGTCATTTTATCTCTCCAGTTATATCAAAAACAGGTTTATGGCCCCTTGTGGAAAATTAATGCTGGAAACCTCCAAGGCATTTCAATAAGCAGTGTGGAGCTGCTGGAAGAACTCCTTCGAAAAGATGAGAAATATCCATGCAGAGGATACATGACTCTGTGGACAGAGCACCGGGACTTAAGAGGCATTAGCTATGGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTTTACAGCCCATTTAAAAAGCAAGTTGGCAAAGTTGGCTAATGTAGCTGTTTCGTGTTATACAAAATCATGAACTCGGTAACACTTTACAATAGGTTCATTAGTTAATGCATTTGCTAACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14111
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 None None 438 None 8
ENSDART00000135748 Nonsense 133 522 2 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472894)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610790
GRCz11 9 38420585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAATATCCRTGCAGAGGAWMCATGACTCTGTGGACAGAGCAYCGGGACT[T/G]AAGAGGCATTAGCTATGGCCCTTTCACAGAGTAAAAACAAAKGATTTGTA
Long Flanking Sequence:
GATGGTGTTTTCTGAGACCCACGGCAGCGGCCACAGGCTTCAGGAGTGCAGCAGGAAATGCTGCGGCTGCTTCTGTCAGTGTCCAGGACGGCCACAGAAAGCTGAAGACTGAGGCTGACCTTCCAGAGATCAAAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGTTACCTCAACAGCGTACATGAGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTGTCATGTGATTTTATCTGCAGGACTCTTGACATTATTGTTATTGTTTATGTCCTGATGCTGTCAGGTGTTTTAATGAATTGAAAAGAAACGGCTGTCATTTTATCTCTCCAGTTATATCAAAAACAGGTTTATGGCCCCTTGTGGAAAATTAATGCTGGAAACCTCCAAGGCATTTCAATAAGCAGTGTGGAGCTGCTGGAAGAACTCCTTCGAAAAGATGAGAAATATCCATGCAGAGGATACATGACTCTGTGGACAGAGCACCGGGACT[T/G]AAGAGGCATTAGCTATGGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTTTACAGCCCATTTAAAAAGCAAGTTGGCAAAGTTGGCTAATGTAGCTGTTTCGTGTTATACAAAATCATGAACTCGGTAACACTTTACAATAGGTTCATTAGTTAATGCATTTGCTAACATGAACTAATCATGAACAACACTTGTACAGCATTTATTAACCATAATTGAACATTTACTAATGCATTATTAACATCCAAACTCACAATGAACTACTGTATTTTCATTAACTAACGTTAACTAACATGAACAAGAACTGTAGTAAATGTATTGTTCATTGTTTGTTCATGTTAGTAAATGCATTAAGTAACATTAACTAATGAACCTTATTGTAAAGTGTGACCATGAACTCTTATCAATTTCCGCTGTTCAGTTTCTCATATGAAAAAAGACTGTGTTGTTCAACAGAGAAGGAGAGAAATGGTACAAACTGCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27447
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 None None 438 None 8
ENSDART00000135748 Nonsense 138 522 2 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39472910)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38610806
GRCz11 9 38420601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATACATGACTCTGTGGACAGAGCACCGGGACTTAAGAGGCATTAGCTA[T/G]GGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTT
Long Flanking Sequence:
ACCCACGGCAGCGGCCACAGGCTTCAGGAGTGCAGCAGGAAATGCTGCGGCTGCTTCTGTCAGTGTCCAGGACGGCCACAGAAAGCTGAAGACTGAGGCTGACCTTCCAGAGATCAAAATCTTTACCATGTTGTATCAAATGCTCTTCAAAGGTTACCTCAACAGCGTACATGAGCTACAGGTATAAAGAAATAACGCAGCTGTATTTGTTTGTCATGTGATTTTATCTGCAGGACTCTTGACATTATTGTTATTGTTTATGTCCTGATGCTGTCAGGTGTTTTAATGAATTGAAAAGAAACGGCTGTCATTTTATCTCTCCAGTTATATCAAAAACAGGTTTATGGCCCCTTGTGGAAAATTAATGCTGGAAACCTCCAAGGCATTTCAATAAGCAGTGTGGAGCTGCTGGAAGAACTCCTTCGAAAAGATGAGAAATATCCATGCAGAGGATACATGACTCTGTGGACAGAGCACCGGGACTTAAGAGGCATTAGCTA[T/G]GGCCCTTTCACAGAGTAAAAACAAAGGATTTGTATAAATAACACTCGTTTTACAGCCCATTTAAAAAGCAAGTTGGCAAAGTTGGCTAATGTAGCTGTTTCGTGTTATACAAAATCATGAACTCGGTAACACTTTACAATAGGTTCATTAGTTAATGCATTTGCTAACATGAACTAATCATGAACAACACTTGTACAGCATTTATTAACCATAATTGAACATTTACTAATGCATTATTAACATCCAAACTCACAATGAACTACTGTATTTTCATTAACTAACGTTAACTAACATGAACAAGAACTGTAGTAAATGTATTGTTCATTGTTTGTTCATGTTAGTAAATGCATTAAGTAACATTAACTAATGAACCTTATTGTAAAGTGTGACCATGAACTCTTATCAATTTCCGCTGTTCAGTTTCTCATATGAAAAAAGACTGTGTTGTTCAACAGAGAAGGAGAGAAATGGTACAAACTGCGGGCGGTGCTGAACAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21546
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100487 Nonsense 217 438 4 8
ENSDART00000135748 Nonsense 301 522 5 9

The following transcripts of ENSDARG00000069186 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39475782)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38613678
GRCz11 9 38423473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCATTCAGAAGCGTGTAGATACCAATCAGGATGTTGCTGGAGAGTA[T/G]CTCACATACCTGCTTTCTAATGGCAAGATAAGCAGGAAAGACGTTTATGG
Long Flanking Sequence:
TTTATTTTATAAGACATAAATGGTGTTAAATTGGTATGCAAATGACCATAATAATGTTAGTCATTTGAATACCAATTTATCACCATTTTAAACATGCTTTCAATTTGCCCACAATAATTGAGATACCTTTCTTCACAGGGATTGCGTCCATTCTCTTCGAGACGCGCATTGGCTGTCTGGAGAAAGAAATTCCTGCTGAGACACAAAAGTTTATTAATTTCATTGCTCAAATGTTCACCTACAGCATGCACGTGGCCCTTCTGCCCAACTGGACCCGCAAATATTTCCCATTCTGGCAGAAGTACATTGATGGCTGGGATGGCATATTCAAGTTCGGTAAGCTTCACACATCTGCTTCAGACTGACTTTAAGAGATTTGTTGTGGAGTTTAATAATGTTTATTGTACTAATGGATTACTCATAGGCACAAAAATGATTGACATGAAGATGGAGGCCATTCAGAAGCGTGTAGATACCAATCAGGATGTTGCTGGAGAGTA[T/G]CTCACATACCTGCTTTCTAATGGCAAGATAAGCAGGAAAGACGTTTATGGAAGTGTATCTGAGCTGCTGCTGGCTGGAGTCGACTCAGTAAGACGCTCCTTCTATAGATTTGACTGTGTAAACAACATTTGTAGGAGTTTTAAAAATTTGTAATTGTCAAGGTTTGGGTTAGGGAAGGACAAGTACTCATATGTAGGACTAAAAGATGGGTTTTTTAAATAAAAAATATAATAAAATGCGGAAAAAAAAAAACAATTGGGGAAAACATTAGCAAAAACAAACTTGGCTTTGCTGGCAGGGAAGAGCAGATCTGAACACGACAGGACAAAACTGGACACTAGAAGAATGACGTACAAACTGGCACAGGACAGTAGACATGAGGGAGCTATAAAGGAGAAAAATTAGCAAACAAATAGGTCAACAGAATTAACTAATAATATATATACTTATAATACATTATATTTTCATACCATATCAAAGACAAAATATATACTGATACA
Associated Phenotype:
Not determined