Busch Lab

ZMP

aars

Ensembl ID:
ENSDARG00000069142
ZFIN ID:
ZDB-GENE-030131-3663
Description:
alanyl-tRNA synthetase, cytoplasmic isoform 2 [Source:RefSeq peptide;Acc:NP_001035124]
Human Orthologue:
AARS
Human Description:
alanyl-tRNA synthetase [Source:HGNC Symbol;Acc:20]
Mouse Orthologue:
Aars
Mouse Description:
alanyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2384560]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36623 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076695 None None 433 None 10
ENSDART00000100401 Essential Splice Site 557 966 12 21
ENSDART00000100425 Essential Splice Site 557 757 12 17
ENSDART00000123557 Essential Splice Site 582 991 12 21
ENSDART00000128265 Essential Splice Site 557 746 13 17
ENSDART00000136544 Essential Splice Site 582 991 13 22
Genomic Location (Zv9):
Chromosome 18 (position 18428754)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18658977
GRCz11 18 18648043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTTTGATGAGGGCTACATGCTTCGAGAAAACGACTCTGCTGAGGATG[T/C]AAGAAACAGACAGTGGTCATCTGAAGATGCTAAATAGTCCATTTCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9719
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076695 None None 433 None 10
ENSDART00000100401 Nonsense 613 966 14 21
ENSDART00000100425 Nonsense 613 757 14 17
ENSDART00000123557 Nonsense 638 991 14 21
ENSDART00000128265 Nonsense 613 746 15 17
ENSDART00000136544 Nonsense 638 991 15 22
Genomic Location (Zv9):
Chromosome 18 (position 18426067)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18656290
GRCz11 18 18645356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRTCGTAGGCCGATCATGAGTAACCACACAGCCACACACATCCTGAACTA[C/A]GGCCTGCGTTCAGTTCTYGGAGAAGCRGATCAGCGAGGCTCTTTGGTTGC
Associated Phenotype:
Not determined