Busch Lab

ZMP

grik1a

Ensembl ID:
ENSDARG00000069139
ZFIN ID:
ZDB-GENE-030131-6502
Human Orthologue:
GRIK1
Human Description:
glutamate receptor, ionotropic, kainate 1 [Source:HGNC Symbol;Acc:4579]
Mouse Orthologue:
Grik1
Mouse Description:
glutamate receptor, ionotropic, kainate 1 Gene [Source:MGI Symbol;Acc:MGI:95814]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27614
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007778 Essential Splice Site 440 887 9 16
ENSDART00000134215 None None 207 None 5
ENSDART00000147089 Essential Splice Site 440 904 9 16

The following transcripts of ENSDARG00000069139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26071500)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25475357
GRCz11 10 25437070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCACAGATTCTCTGGCCAACAGGACCCTTATCGTCACCACCATTCTGG[T/A]AAAAAAAAAATACAAACAGTTTTTATGTAATTTTTAAAATTTATTTTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3779
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007778 Essential Splice Site 696 887 14 16
ENSDART00000134215 None None 207 None 5
ENSDART00000147089 Essential Splice Site 696 904 14 16
ENSDART00000007778 Essential Splice Site 696 887 14 16
ENSDART00000134215 None None 207 None 5
ENSDART00000147089 Essential Splice Site 696 904 14 16

The following transcripts of ENSDARG00000069139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26047296)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25451153
GRCz11 10 25412866
KASP Assay ID:
2260-3274.1 (used for ordering genotyping assays)
KASP Sequence:
AGTGCTTCATAAATTAAGNNTTGAGGGTAAAGTAAATGTTATTTTTTACTTT[A/G]GAAATCAAAAATCTCAACGTACGAGAAGATGTGGGCATTCATGAGCAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18985
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007778 Essential Splice Site 696 887 14 16
ENSDART00000134215 None None 207 None 5
ENSDART00000147089 Essential Splice Site 696 904 14 16
ENSDART00000007778 Essential Splice Site 696 887 14 16
ENSDART00000134215 None None 207 None 5
ENSDART00000147089 Essential Splice Site 696 904 14 16

The following transcripts of ENSDARG00000069139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26047296)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25451153
GRCz11 10 25412866
KASP Assay ID:
2260-3274.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGCTTCATAAATTAAGTTGAGGGTAAAGTAAATGTTATTTTTTACTTT[A/G]GAAATCAAAAATCTCAACGTACGAGAAGATGTGGGCATTCATGAGCAGCA
Associated Phenotype:
Not determined