Busch Lab

ZMP

si:ch211-216l23.2

Ensembl ID:
ENSDARG00000069122
ZFIN ID:
ZDB-GENE-030131-3806
Description:
hypothetical protein LOC565061 [Source:RefSeq peptide;Acc:NP_001038534]
Human Orthologue:
NCOA5
Human Description:
nuclear receptor coactivator 5 [Source:HGNC Symbol;Acc:15909]
Mouse Orthologue:
Ncoa5
Mouse Description:
nuclear receptor coactivator 5 Gene [Source:MGI Symbol;Acc:MGI:2385165]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44888 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23278 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2980
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100341 None None 474 None 9
ENSDART00000135236 Essential Splice Site None 474 2 10
ENSDART00000137239 None None 119 1 4
Genomic Location (Zv9):
Chromosome 18 (position 17414112)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17765878
GRCz11 18 17754944
KASP Assay ID:
554-3267.1 (used for ordering genotyping assays)
KASP Sequence:
ATTATGTTTACTGTGGCTTTCTGTAACGATATACTGAAATTTWTCTAGAA[G/A]AGGTGAAATGTCGTCGTGGGGAAAAAAAGCCGGGGGCAGACGACAAAAAC
Long Flanking Sequence:
TTGGTCTGCCAGGCCGACAGGCGGCGGCATAAATACTCTTTCTCGACGAAAGGAAGTCGGATCTAGAATGAAGCGTTAGCAGGTCTATTGGCGGAATCCTTGAGGAGTAGCACGGATTAGCAACTATTATTCACACATTTTGTCTAAAAATAATCTCACTTTGTATTGATCACGTCGAAGATTAAACAACGCATCTGCAAATTAATCAATTTATCGCGATAAACAAAAGCCACAGGAGTACGTTACAGCCGTATCTCTGCCAAGGTACGACGAAATTCGCTTCAGATTTGTGTTTTAATAGCAATAGTTTTAATAAATATTTTTTTATATTGGACTTTGTTTTAACTGTAGATATGCATATGTTCATTTTTTAAGAAATTAGGGTTGAGCCAATGCAGAATTAGCTTGATAAACAGAACGCTGCCATCTTGTGCCGCGCGGTATTTGTTTATTATGTTTACTGTGGCTTTCTGTAACGATATACTGAAATTTATCTAGAA[G/A]AGGTGAAATGTCGTCGTGGGGAAAAAAAGCCGGGGGCAGACGACAAAAACACGGAGGAGGAGGGTATGATACGCACACACACGGACAAAAAGGCATTTCAAGCATCATAACAATGAAAGACGCTTGTTGTGTTGTGTAACGTTAACAATGCATTTTTTACACGAGTAAGTTACATTGAAGGTTATTTTCTAATAAATTAATGAAGCATGAATTGAATAAGCTAAATTGGCTTTGTTTTTGAATGCTAGTGTGTATGGGTGTTTCCCATTACTTGGTTGCGGCTTGAAGGGCATCCACTGCGTACATCATATTCTGGAAAAGTTGGCAGTTCATTCCACCGTTGCGACCCTTATTAAATAAGGGGACTATGTTAAAGAGAAAATGAATGGATGAATGAATAAATGAAACTGTCAATCTTTGTGTAAACAAAATCTCTTATGTCTAGCAACTTACAATATGTAAATAAACATTATTTGTTTATTATTTTGTACACATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100341 Essential Splice Site 186 474 5 9
ENSDART00000135236 Essential Splice Site 186 474 6 10
ENSDART00000137239 None None 118 None 4
Genomic Location (Zv9):
Chromosome 18 (position 17421968)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17773734
GRCz11 18 17762800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAACACTTTCCTCGTGCACAGTAATCATATTTTCAGAGTCCCTCAAAAG[T/C]AAGTCCCAACTCCCACAAGCTGTTTTCCATTTAAACCACTTTAAATGTTC
Long Flanking Sequence:
CTAATAATTTAGGAGGGCTGATAATTCTGACTTCAACTTTATATGTAATGTGTAAAATGATGATGTTTTTCAAAGTCCTCGGGCAAAAGCATTTATTCGGGTAAAAACAGGACAATTTTGTCATTTTAATATTTTTTACACACTTTTAATATGCTGAACAGATTTGTGTTGGTTTATTTATCCGTGTGGCACATTAAATCCTAACACATTCATTGCTGCATATATCAACCAGGCCACACCCAACAGCCTCAGCTGAAGCGCGGTGCGCAATAACCACATCTCTTCTTCTTCTTTCAAAGGGAATACCCCAAATCATTAGGCCAGTGTTTGCAGGAACTTGGCCTCACTGTGGAAATGCTTTACCTGCAGTCGGAATCAGGCCTGACGCGGGCCCTCCAAGATGTCCGCTCCGACGGTTCCCCCTTTTGTATTCTCGTCGAGCAGACTAATGTAACACTTTCCTCGTGCACAGTAATCATATTTTCAGAGTCCCTCAAAAG[T/C]AAGTCCCAACTCCCACAAGCTGTTTTCCATTTAAACCACTTTAAATGTTCTACAGTTACTACAATTAAATATACAGAACAAGAGAACTACAGTAAAATACATTTGATCTGGTGGTGGGCATTTTTAGTAAATCTTAACTGACATCATTTATGTTTGTGATTGCACAAAAAATACATAAATAACCAATTCTGGAAATACACTGCCAAAACAATTCAACAATGTCAAAAACTGCAAAACAAAAAGTCTACCAACTGCAAAAACAAACAAAAAAGGTCAAAGAATGGCAAAAGCATCAGTGTTTTGTCCAATAATGCAGACATTGCAAAATATTGTAATTCTAAGAATGTTAAAAGCTTCGTTGGACATGACACCAAAATATAAAACATGACCTGTATTTTTGGGTAGAAACATGCTTACAGATTTTTTTTTCTGAAAATATTTAATATTCTAATGCCGAGTTCAGACTGCATGATTTTCTGCATGATGACAGATTTTTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100341 Nonsense 188 474 6 9
ENSDART00000135236 Nonsense 188 474 7 10
ENSDART00000137239 None None 119 None 4
Genomic Location (Zv9):
Chromosome 18 (position 17427561)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17779327
GRCz11 18 17768393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCTCTCCCTCCGCTGGCTGACCCTTCCTCTGCCTCTCTACAGTTCAT[C/T]GAAATATGCCTAAAGAACATGCTATGGAGTTTGTGTTGACGGAGTATGGG
Long Flanking Sequence:
CAAATACACATATTTACATTTAAAATAGTTTTCGATGCAGTCCTAGTTTCGATTTTCCACATTTAATGACTAATTCAGACTATTGATATGACAACATAGACAAAGAGCATATGTGCTAGTCACCCATTGGCTGTAGTGTATGCAGTGTGTTTCAATGCATCTTAGCCATGTAATGTAAGACGACAACACTGTCAAATTTGTCGTCTATTTTGTTGTCACAGTGAGTCTAAAAATGCTCACACTTAAAAAGCAATCTTTTAACTTTTACTCCAAGTGTCCCTATACCCAACTGGCAGGCGGGCTCATGAATGCATCTTTGAGTGCCTTCTGAATGTTGATGTAGTAATGGGGTTAAGCAGCGGTTGGCCGACTGCAGTATGTGTTGCTGATGAGGTGAAACTCTTCTACACACTGCTTAGACTGCAGCGCCTCACACTGAGCACCATATGTAACCCTCTCCCTCCGCTGGCTGACCCTTCCTCTGCCTCTCTACAGTTCAT[C/T]GAAATATGCCTAAAGAACATGCTATGGAGTTTGTGTTGACGGAGTATGGGCGCCAGAGCAGCCCGCAGCGGGCGTTGAACCCCACGGAGGCTGCGACGCGGGCGGCTGAGCTGACGGAGGACTACCTGGAGCGCGGCAAGCTGGAGCGCCACACCGTTCCCTTCACCACCCGCCACCTGCTCTTCCTCCTGGCCGAAGGGTTGCACCTGTACCCGGAGGAGGTTAGCACACTGGCTGTGTTTCTCCAGAACCGCCAGGACCATCTGCAAGGTGAGTGTGCTGGCCTAGTTACGCTCCTATCATAGGGGTTCATCATTTTTTTGTGTTTCTTTGTGCATGATGTCATTTAATGAGCTCCAGTTAGTTTGCTAGGTGTGTGTGTGTGTGTGTGTGTTTGAGGAATAAATCTATGCATATTATACGTTGAATATGTACAAGAATTTGAAGCTGACACAGGGGAGCGGACATTTGTTGACCAAGCAATGACCAGGCCCACATGG
Associated Phenotype:
Not determined