Busch Lab

ZMP

si:ch211-251m13.1

Ensembl ID:
ENSDARG00000069117
ZFIN ID:
ZDB-GENE-090311-23
Description:
Novel protein similar to H.sapiens KCNH5, potassium voltage-gated channel, subfamily H (Eag-related)
Human Orthologue:
KCNH5
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 [Source:HGNC Symbol;Acc:6254]
Mouse Orthologue:
Kcnh5
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa31956 Nonsense Available for shipment Available now
sa10517 Nonsense Available for shipment Available now
sa35563 Nonsense Mutation detected in F1 DNA Not yet available
sa15450 Nonsense Available for shipment Available now
sa22359 Nonsense Available for shipment Available now
sa13966 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31956
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 146 994 5 12
ENSDART00000138934 Nonsense 146 675 5 10
Genomic Location (Zv9):
Chromosome 13 (position 37767458)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37244270
GRCz11 13 37370160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAAATGTATTATGTGTCTTTCACTCAGTACGTAAATATCTTTTAGGTT[G/A]GACCAAGTTTGCACGTTTGACTCGAGCGTTGACCAACAGCAAAAGCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10517
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 305 994 6 12
ENSDART00000138934 Nonsense 304 675 6 10
Genomic Location (Zv9):
Chromosome 13 (position 37762608)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37239420
GRCz11 13 37365310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTACCTCAAGACCTGGTTCGTTATAGACTTGCTGTCCTGTCTGCCCTA[T/G]GACATCATCAAYGCWTTTGAAAACGTGGATGAGGTGAGCGGACCTGTYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 390 994 7 12
ENSDART00000138934 Nonsense 389 675 7 10
Genomic Location (Zv9):
Chromosome 13 (position 37748021)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37224833
GRCz11 13 37350723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTATGAGGTCATTGACGAACAAACCAACACCATCAAGACTGACAGCTG[G/A]CTCTTCCAGTTAGCCACCAGCATCGGGTCCCCGTACCGCTACAATGCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3848
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 666 994 10 12
ENSDART00000138934 Nonsense 664 675 10 10
Genomic Location (Zv9):
Chromosome 13 (position 37720378)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37197190
GRCz11 13 37323080
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCYTGCTGAAAGTGTTGGACTTCTACACGGCTTTTGCAAACTCYTTCTCC[A/T]GAAATCTATTTCTCACCTGCAACCTACGCAAAAGGGTGAGAGACATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 718 994 11 12
ENSDART00000138934 None None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37700745)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37177557
GRCz11 13 37303447
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTCACCATTCCTGTGGACCATCCAGTCCGAAAACTTTTCCAGAAGTTT[A/T]AGCAGCAGAAAGAGCTCAGAAACCAGGGCGCTTCAGCCCAGCTGGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 945 994 12 12
ENSDART00000138934 None None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37700025)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37176837
GRCz11 13 37302727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGATGGAGATCCAGGCTCTGAACGGAAGGATGGCAACTTTGGAAGAA[C/T]GAGTCGGACAAATTCTCAGACTTCTTTTAGACTCTTCGAAAGCCAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13966
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 957 994 12 12
ENSDART00000138934 None None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37699988)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37176800
GRCz11 13 37302690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTTGGAAGAACGAGTCGGACAAATTCWCAGACTTCTTTTAGACTCTT[C/A]GAAAGCCAAGTCTAGTGAAGACTTGACTCATAGACCCAAACTCAAAKCAC
Associated Phenotype:
Not determined