Busch Lab

ZMP

zgc:103754

Ensembl ID:
ENSDARG00000069109
ZFIN ID:
ZDB-GENE-041010-102
Description:
Sjogren syndrome/scleroderma autoantigen 1 [Source:RefSeq peptide;Acc:NP_001006010]
Human Orthologue:
SSSCA1
Human Description:
Sjogren syndrome/scleroderma autoantigen 1 [Source:HGNC Symbol;Acc:11328]
Mouse Orthologue:
Sssca1
Mouse Description:
Sjogren's syndrome/scleroderma autoantigen 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1913482

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34923 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34923
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100301 Nonsense 158 234 4 4
Genomic Location (Zv9):
Chromosome 10 (position 27467124)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26869918
GRCz11 10 26831631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTACAGCCAACCCCTCTTTCCATCCCCACCCCTGCCTCCAACTTCT[T/A]GCCGCCATCCAACCCGCCTGTCCAGACGACACCTCCTGTAGGGTCTTCGG
Long Flanking Sequence:
AGCATGGATTCATTGTTCACCTAAAGAATAACAAAATAATCATTGTACATTTTTTCTCACAGACTTTAATTGTTATTACTTATTACAGTGTTTAAAGCAAAACAAAACTTCCATCTATTTGCAGACGATTCTGCTGCAAGATAAGCAGAAGAAAAATTACTGTGTTGCTTGTCAAGAGCTGGACTCCGATGTTGACAAGGACAACCCAGGTACATTCAAATCCTCTTCCTTAAACATAAATTCTTGCTCATCACCATTAAATTATCCAACTTTTCTTTCAGCTTTAAATGCTCAAGCAGCCTTGTCACAGGTACGAGAGCGCCAGCTTGCCACTCAGCCTGTTCCCGAATCTAACGGAGCCTCCTCCAGTGAACCCCCTCTCTCCATCACTGGCCAGCCCAGGCCGGAGCACTGTGAGGGGGCTGCGTCTGGACTCAGAGGCCCCCCTCCAACTGTACAGCCAACCCCTCTTTCCATCCCCACCCCTGCCTCCAACTTCT[T/A]GCCGCCATCCAACCCGCCTGTCCAGACGACACCTCCTGTAGGGTCTTCGGGCAGCTCACTCCATCACCACCCAGCCCTGTCCAGTGCAGAAGAGGCTGTGCTTCACAAGCTCAGATGGGCCACGCAGGAGCTCCAGCACGCCGCATCAGTGGAGGCCAGCATTCAGCTCTGCAATCTGATCCGAGGCTGTGCCGAGTCCCTGAGGAGCCTGAAAGAACTGCAGCTCTCATAAGACTGAACTACAGACAGGGCTGTAACAACACACACACACACATGTAAGGAAATATGAAAGGCACTAATTTATATATAGTAACATACTCAAGCAGATTGTTTGGGGTTGTGTTTATGTTGGATTTAAAGCAGCTGAGTATGTGAATGTGTTGTGTGTTGAAATACATCGCTTGAGCTGCAAAGGATGCTTTCTTTGTCCTTGTTTTTTGTGTGTGTGTTTGCATCATGCTAAAAGTGCAAAGAGCTTTCTTTGTGATTTTTGTAAATTT
Associated Phenotype:
Not determined