Busch Lab

ZMP

fgfr4

Ensembl ID:
ENSDARG00000069105
ZFIN ID:
ZDB-GENE-980526-488
Description:
Fibroblast growth factor receptor 4 [Source:UniProtKB/Swiss-Prot;Acc:Q90413]
Human Orthologue:
FGFR4
Human Description:
fibroblast growth factor receptor 4 [Source:HGNC Symbol;Acc:3691]
Mouse Orthologue:
Fgfr4
Mouse Description:
fibroblast growth factor receptor 4 Gene [Source:MGI Symbol;Acc:MGI:95525]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
hu3514 Nonsense Available for shipment Available now
sa24005 Nonsense Available for shipment Available now
sa6682 Nonsense Mutation detected in F1 DNA Not yet available
sa24004 Essential Splice Site Available for shipment Available now
sa37357 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
hu3514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 43 922 3 20
Genomic Location (Zv9):
Chromosome 21 (position 36516834)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37506183
GRCz11 21 37191370
KASP Assay ID:
554-0053.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACTCCAGCAGATATCAGAGTTTCACGACACATACTTACTCCTGGATA[T/A]CCTGAGAATGCTACTGTGTTGGTCGGAGGACATGTGAAGCTGGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24005
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 173 922 5 20
Genomic Location (Zv9):
Chromosome 21 (position 36516140)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37505489
GRCz11 21 37190676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGTACTTAAACTCCGTTGTGACACAAACCGTCCTGGAGCTGTCCAGT[G/A]GTTCAAGAGTGGTGTTCGGGTGCAACACAATGCCCGTATCCAGATAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4147
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Essential Splice Site 312 922 7 20
Genomic Location (Zv9):
Chromosome 21 (position 36515549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37504898
GRCz11 21 37190085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAAATGGCAGAGAATTCCGAGGAGAGCACAGGATTGGTGGCATCAAGG[T/C]GAAAGATTTTTAATCTATTGGAGGCTTAGCAMTGGCTTGAACTTCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6682
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 405 922 9 20
Genomic Location (Zv9):
Chromosome 21 (position 36514493)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37503842
GRCz11 21 37189029
KASP Assay ID:
554-5175.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCCTCACATCCAGTGGCTCAAGCRTATAGAAATGAATGGCAGCCGTTA[T/A]GGGCCTGATGGCATTCCTTATGTGAAGATTGTGAAGGTATATAGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24004
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Essential Splice Site 577 922 13 20
Genomic Location (Zv9):
Chromosome 21 (position 36513599)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37502948
GRCz11 21 37188135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTCATGTAATGGTGAACTAACTAGTTATTTAAATTCTCTCATGCCA[G/A]TTTGACTTTAGGGAAACCGCTTGGAGAGGGTTGCTTTGGTCAAGTGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 784 922 18 20
Genomic Location (Zv9):
Chromosome 21 (position 36511667)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37501016
GRCz11 21 37186203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATCCTACATAGTCTCCTGACATATTTGACCTCTGGTTTTCACAGATG[G/A]TCTTTCGGGGTTTTGATGTGGGAGATATTCACATTGGGAGGATCGCCGTA
Associated Phenotype:
Not determined