Busch Lab

ZMP

si:rp71-81o21.2

Ensembl ID:
ENSDARG00000069101
ZFIN IDs:
ZDB-GENE-050522-230, ZDB-GENE-050522-230, ZDB-GENE-060503-566, ZDB-GENE-070112-2132, ZDB-GENE-070112-2132
Description:
hypothetical protein LOC568195 [Source:RefSeq peptide;Acc:NP_001038621]
Human Orthologue:
NAPB
Human Description:
N-ethylmaleimide-sensitive factor attachment protein, beta [Source:HGNC Symbol;Acc:15751]
Mouse Orthologue:
Napb
Mouse Description:
N-ethylmaleimide sensitive fusion protein attachment protein beta Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16970 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16970
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100290 Essential Splice Site 188 295 8 11
ENSDART00000124582 Essential Splice Site 188 295 8 11
ENSDART00000131251 None None 137 None 4
Genomic Location (Zv9):
Chromosome 20 (position 45848236)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45741925
GRCz11 20 45645645
KASP Assay ID:
2261-4866.1 (used for ordering genotyping assays)
KASP Sequence:
TAAACATCACTCAGCGGTGCCTGTATGTNNNNNNNNNNGTGTGTGTAAAC[A/T]GGTTGGAAGCAACACCATGGACAATCCCCTTCTGAAATACAGCGCCAAAG
Associated Phenotype:
Not determined