Busch Lab

ZMP

xrn2

Ensembl ID:
ENSDARG00000069092
ZFIN ID:
ZDB-GENE-040426-2874
Description:
5'-3' exoribonuclease 2 [Source:RefSeq peptide;Acc:NP_001001944]
Human Orthologue:
XRN2
Human Description:
5'-3' exoribonuclease 2 [Source:HGNC Symbol;Acc:12836]
Mouse Orthologue:
Xrn2
Mouse Description:
5'-3' exoribonuclease 2 Gene [Source:MGI Symbol;Acc:MGI:894687]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37162 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37162
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239 Essential Splice Site 356 540 11 18
ENSDART00000100246 Essential Splice Site 356 952 11 31
ENSDART00000137314 Essential Splice Site 80 273 3 9
ENSDART00000146596 Essential Splice Site 356 540 11 32
Genomic Location (Zv9):
Chromosome 20 (position 49008408)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49044874
GRCz11 20 48876091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTGTGGGAAATGACTTCTTGCCCCACTTACCGTCTCTTGAGATCAGG[T/C]ACGCTCCCAAAAACACTTTATCTCTTCTGTATGCTCTGCAGTGAGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17318
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239 None None 540 None 18
ENSDART00000100246 Nonsense 721 952 24 31
ENSDART00000137314 None None 273 None 9
ENSDART00000146596 None None 540 25 32
Genomic Location (Zv9):
Chromosome 20 (position 49038968)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49014314
GRCz11 20 48845531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTCARTAATTTCCCAATCTTTCTCTTYAAGGCCACTGAGATCCCTGCA[G/T]AGTTTTGTCRTGGAATCCAAGGTATATTAAATCTTGATGAAGACCCTATT
Associated Phenotype:
Not determined