Busch Lab

ZMP

zgc:136924

Ensembl ID:
ENSDARG00000069058
ZFIN ID:
ZDB-GENE-060312-19
Description:
hypothetical protein LOC556717 [Source:RefSeq peptide;Acc:NP_001034900]
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7236 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7236
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100185 Nonsense 166 281 5 7
Genomic Location (Zv9):
Chromosome 15 (position 30320445)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31142152
GRCz11 15 31022893
KASP Assay ID:
554-4942.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAGACCGTCCCATATAAAACCCTGATCAGTGATGGACTGCAGTCTGGC[A/T]AAGACATTNNNATTCATGGAGTTCCTAAAGCTGACTCAGACAGGTGAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa563
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100185 Nonsense 189 281 6 7
Genomic Location (Zv9):
Chromosome 15 (position 30320248)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31141955
GRCz11 15 31022696
KASP Assay ID:
554-0473.1 (used for ordering genotyping assays)
KASP Sequence:
TTTAATGTTTGTATCTTCATTAGGATGACGTTTAATCTGCGCCACAGATA[T/A]GGGATTGCATTTCACTACCAATGCCGTTTTGATCAGAATGCTGTTGTCCG
Associated Phenotype:
Not determined