Busch Lab

ZMP

serpinf1

Ensembl ID:
ENSDARG00000069048
ZFIN ID:
ZDB-GENE-040912-2
Description:
pigment epithelium-derived factor [Source:RefSeq peptide;Acc:NP_001004539]
Human Orthologue:
SERPINF1
Human Description:
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member
Mouse Orthologue:
Serpinf1
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade F, member 1 Gene [Source:MGI Symbol;Acc:MGI:108080]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39347 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39347
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100166 Nonsense 359 406 8 8
Genomic Location (Zv9):
Chromosome 21 (position 38955741)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40095806
GRCz11 21 40119359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATGCAGTCCATCATAAGGTTGTCCTGGAGACAGCTCCAGAGGGCGCA[G/T]AGTATGCCAGCACCACACCCAGTGCCACAGGTCAATCGCTGGGTCTATCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29653
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100166 Nonsense 371 406 8 8
Genomic Location (Zv9):
Chromosome 21 (position 38955778)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40095843
GRCz11 21 40119396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGAGGGCGCAGAGTATGCCAGCACCACACCCAGTGCCACAGGTCAAT[C/A]GCTGGGTCTATCGTACCGTGTGGACCGGCCCTTCCTTTTTCTAGTCAGGG
Associated Phenotype:
Not determined