Busch Lab

ZMP

agpat4

Ensembl ID:
ENSDARG00000069044
ZFIN ID:
ZDB-GENE-040426-1924
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase delta [Source:RefSeq peptide;Acc:NP_998157]
Human Orthologue:
AGPAT4
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) [Sourc
Mouse Orthologue:
Agpat4
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35549 Splice Site, Nonsense Available for shipment Available now
sa2710 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa35549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100156 Splice Site, Nonsense 60 377 2 9
Genomic Location (Zv9):
Chromosome 13 (position 36174602)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35647278
GRCz11 13 35773110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCGCACGCAAGATCAACTGCAGACTGGGTTACTCCATCGCTAGT[C/T]GTAAGTCCTGCAAAATGTTCTTTTGTTTGTTTAACTTGATGTACTTTATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28163
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100156 Essential Splice Site 60 377 2 9
Genomic Location (Zv9):
Chromosome 13 (position 36174604)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35647280
GRCz11 13 35773112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTCGCACGCAAGATCAACTGCAGACTGGGTTACTCCATCGCTAGTCG[T/A]AAGTCCTGCAAAATGTTCTTTTGTTTGTTTAACTTGATGTACTTTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2710
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100156 Nonsense 145 377 4 9
Genomic Location (Zv9):
Chromosome 13 (position 36176850)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35649526
GRCz11 13 35775358
KASP Assay ID:
554-3315.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTTCCTGTGATTGGCTGGATGTGGTATTTCCTGGAGATTGTCTTCTGC[A/T]AAAGGAAATGGGAAGAGGATCGCAAKACAGTCGTGCAGAGTCTGCGCAAC
Associated Phenotype:
Not determined