Busch Lab

ZMP

si:dkey-287h13.1

Ensembl ID:
ENSDARG00000069011
ZFIN ID:
ZDB-GENE-060503-164
Description:
Novel protein similar to vertebrate epidermal growth factor receptor pathway substrate 8 (EPS8) [Sou
Human Orthologue:
EPS8L2
Human Description:
EPS8-like 2 [Source:HGNC Symbol;Acc:21296]
Mouse Orthologue:
Eps8l2
Mouse Description:
EPS8-like 2 Gene [Source:MGI Symbol;Acc:MGI:2138828]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32197 Essential Splice Site Available for shipment Available now
sa8563 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32197
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100057 None None 121 None 3
ENSDART00000127636 Essential Splice Site 36 70 None 3
ENSDART00000136626 Essential Splice Site 39 242 None 7
Genomic Location (Zv9):
Chromosome 18 (position 16094668)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16446434
GRCz11 18 16435500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTACTGTGATAATGCTAGACATAAATTAGATGAGTGTCTTGTACTGC[A/G]GGTCTTGGAAAACAACCAACAGTGGTGGTTATTGAGGAACCGCAGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100057 Essential Splice Site 69 121 2 3
ENSDART00000127636 None None 70 None 3
ENSDART00000136626 Essential Splice Site 174 242 5 7
Genomic Location (Zv9):
Chromosome 18 (position 16097091)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16448857
GRCz11 18 16437923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGYCCTTTGAGGTCCACGCTTGGCTCAATGCGAAGGGATTTTCTAGGCC[G/A]TGAGTGAMACATGTGACACTTTAGAATTAGATGATATATGAGTGGTSTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29008
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100057 Nonsense 109 121 3 3
ENSDART00000127636 None None 70 None 3
ENSDART00000136626 Nonsense 214 242 6 7
Genomic Location (Zv9):
Chromosome 18 (position 16099171)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16450937
GRCz11 18 16440003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGTGCGGGGACGAGGGTTCACGTGTCTACAGTCAGATCACCGTGCAG[A/T]AAGCTCAAATAGAGGTTTGTCACAAAGCAATATTGCTTATGTTCGTTCAA
Associated Phenotype:
Not determined