Busch Lab

ZMP

bsx

Ensembl ID:
ENSDARG00000068976
ZFIN ID:
ZDB-GENE-040628-4
Description:
Brain-specific homeobox protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6R3Q6]
Human Orthologue:
BSX
Human Description:
brain-specific homeobox [Source:HGNC Symbol;Acc:20450]
Mouse Orthologue:
Bsx
Mouse Description:
brain specific homeobox Gene [Source:MGI Symbol;Acc:MGI:2669849]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41686 Nonsense Mutation detected in F1 DNA Not yet available
sa10675 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090003 Nonsense 44 245 1 3
ENSDART00000099983 Nonsense 26 227 1 3
Genomic Location (Zv9):
Chromosome 10 (position 30800167)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 30006070
GRCz11 10 29892410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCCAGATGCCGACTCAAAGGTCAACGTCGTTCTTCATTGAAGATATTT[T/A]ACTACATAAACCTAAACCTTTGCGGGAGGTGTTTCCCTCGCCTTTTTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090003 Nonsense 121 245 2 3
ENSDART00000099983 Nonsense 103 227 2 3
Genomic Location (Zv9):
Chromosome 10 (position 30799079)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 30004982
GRCz11 10 29891322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGATGCCAGCGTTATTTCAGCATCATCCGGAATTACCAGGAAAGCATTG[C/A]AGACGCAGAAAGGCCAGAACAGTGTTCTCAGRCTCACAGTTATCCGGACT
Associated Phenotype:
Not determined