Busch Lab

ZMP

zgc:153372

Ensembl ID:
ENSDARG00000068967
ZFIN ID:
ZDB-GENE-060929-680
Description:
hypothetical protein LOC767695 [Source:RefSeq peptide;Acc:NP_001070101]
Human Orthologue:
AS3MT
Human Description:
arsenic (+3 oxidation state) methyltransferase [Source:HGNC Symbol;Acc:17452]
Mouse Orthologue:
As3mt
Mouse Description:
arsenic (+3 oxidation state) methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1929882]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14814 Essential Splice Site Available for shipment Available now
sa4615 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1927
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099958 Nonsense 45 358 2 11
Genomic Location (Zv9):
Chromosome 15 (position 29080093)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29798123
GRCz11 15 29730999
KASP Assay ID:
554-1916.1 (used for ordering genotyping assays)
KASP Sequence:
CGTGTGTTCTGCCCTCCAAACCCCTGGCCAAGACCGCATGTGAAGCCCTC[A/T]AACAAGTTCACCCGGATGTTTGCAAGAGGTACAGNATCCCTGAGCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099958 Essential Splice Site 244 358 7 11
Genomic Location (Zv9):
Chromosome 15 (position 29081828)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29799858
GRCz11 15 29732734
KASP Assay ID:
2260-8653.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAGGAAGTCACATTGTGGTTCACAACTCAGAACTTCAAAGAAAGATTG[G/A]TAATCYGTTTATTTGGGGTTTGGTTACAGCTTCATAGCTATTTTTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4615
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099958 Nonsense 249 358 8 11
Genomic Location (Zv9):
Chromosome 15 (position 29081967)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29799997
GRCz11 15 29732873
KASP Assay ID:
554-3527.1 (used for ordering genotyping assays)
KASP Sequence:
AACCAGTGTTATTTTGACCTCCAATTGGTCACTGCAGGTGATGTCAAATA[T/G]GCAWCTGGAACTTATCGGATCTTTAAACTTCCTCAAAACTCCACCAAAAG
Associated Phenotype:
Not determined