Busch Lab

ZMP

nrip1a

Ensembl ID:
ENSDARG00000068965
ZFIN ID:
ZDB-GENE-040723-8
Description:
RIP140-A [Source:UniProtKB/TrEMBL;Acc:Q1L666]
Human Orthologue:
NRIP1
Human Description:
nuclear receptor interacting protein 1 [Source:HGNC Symbol;Acc:8001]
Mouse Orthologue:
Nrip1
Mouse Description:
nuclear receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1315213]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22669 Nonsense Available for shipment Available now
sa22670 Nonsense Available for shipment Available now
sa6382 Nonsense Mutation detected in F1 DNA Not yet available
sa32041 Nonsense Available for shipment Available now
sa5882 Nonsense Mutation detected in F1 DNA Not yet available
sa6383 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 286 1044 1 1
ENSDART00000135540 Nonsense 286 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29059331)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29777361
GRCz11 15 29710237
KASP Assay ID:
2260-8650.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGCAACAGTATTCTCGAGAGCATGCCCTGAAAGCCAAACTTTCTGGA[C/T]GATCAGCCAGTGAAAGACTATCTGCCATGGCCACACAACAGACACCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22670
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 371 1044 1 1
ENSDART00000135540 Nonsense 371 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29059588)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29777618
GRCz11 15 29710494
KASP Assay ID:
2260-8651.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGAGCGTCGACCTTTCGAAAAACAAGGCAGACCATCACAGAATTG[T/A]AGCAGTCTTCTTCTTCAGCTTCTTAACAGTCACAACACCTCACAGCGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28477
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 848 1044 1 1
ENSDART00000135540 Nonsense 848 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061017)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779047
GRCz11 15 29711923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTCAAAGAAGATTCAGCTGAAACCCAGGGACCAACAATCCCAAAGAAG[C/T]GAAAGTTTTCGATAGAACAAGAACATCAAAACTCTTTAATTCAGCCGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6382
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 889 1044 1 1
ENSDART00000135540 Nonsense 889 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779170
GRCz11 15 29712046
KASP Assay ID:
554-5282.1 (used for ordering genotyping assays)
KASP Sequence:
GCATAAAAGAAGACAATGGTAGTTATTTTGCCACTGAAGGTCTAGAGACT[A/T]GAGAAGCMAGAGACCCAYCTAGCCCCCCTGAGGCAGACAGTCCACCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32041
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 910 1044 1 1
ENSDART00000135540 Nonsense 910 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061205)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779235
GRCz11 15 29712111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATCTAGCCCCCCTGAGGCAGACAGTCCACCAGCTAGGTTTCCACCGTA[T/A]GAGTCTAACGAAAACCGAAGTTTCAATGTTTTAAAGCAGCTGCTTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5882
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 964 1044 1 1
ENSDART00000135540 Nonsense 964 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061365)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779395
GRCz11 15 29712271
KASP Assay ID:
554-3682.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTGTTGAATGGAAATACAATCAAGCAACCATGCAATGGAGGTGAGCAT[C/T]AAAACCTTCAMAGAAGTCTGAGCCCCAGCAGTGCTTCTTCTAAAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6383
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 None None 1044 None 1
ENSDART00000135540 Nonsense 1062 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061659)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779689
GRCz11 15 29712565
KASP Assay ID:
554-4408.1 (used for ordering genotyping assays)
KASP Sequence:
GCAATGCACAACTGGTTAAAGAGGGGGAGGGACTAGAGGTAGGCTYGGGA[C/T]AAATGCAGACAAAGGTCAAAAATGAGTCATCAGGTGATACTGAGGCCTTT
Associated Phenotype:
Not determined