Busch Lab

ZMP

zgc:158862

Ensembl ID:
ENSDARG00000068963
ZFIN ID:
ZDB-GENE-070209-146
Description:
hypothetical protein LOC100009628 [Source:RefSeq peptide;Acc:NP_001076466]
Human Orthologues:
LTBR, TNFRSF11A, TNFRSF4
Human Descriptions:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
tumor necrosis factor receptor superfamily, member 4 [Source:HGNC Symbol;Acc:11918]
Mouse Orthologues:
Ltbr, Tnfrsf11a, Tnfrsf4
Mouse Descriptions:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]
tumor necrosis factor receptor superfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:104512]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27190
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099955 Nonsense 23 248 2 9
Genomic Location (Zv9):
Chromosome 8 (position 23346868)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTTTTCTTAACAGTTTTTTGTACACTTCCCGGATTTGGAGATGCTTG[C/A]GGGCCCAGTGAATATAAATCAGCTGCTGGAGAGTGTTGTCCAATGTGCAG
Associated Phenotype:
Not determined