Busch Lab

ZMP

si:ch73-19n18.2

Ensembl ID:
ENSDARG00000068923
ZFIN ID:
ZDB-GENE-091204-140
Description:
LOC567806 protein [Source:UniProtKB/TrEMBL;Acc:A1L2F9]
Human Orthologue:
UMODL1
Human Description:
uromodulin-like 1 [Source:HGNC Symbol;Acc:12560]
Mouse Orthologue:
Umodl1
Mouse Description:
uromodulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1929785]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa10685 Essential Splice Site Available for shipment Available now
sa30942 Nonsense Mutation detected in F1 DNA Not yet available
sa10242 Essential Splice Site Available for shipment Available now
sa27634 Nonsense Mutation detected in F1 DNA Not yet available
sa18380 Nonsense Available for shipment Available now
sa41690 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10685
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 106 950 2 17
ENSDART00000126952 Essential Splice Site 106 927 2 16
Genomic Location (Zv9):
Chromosome 10 (position 33590793)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32692142
GRCz11 10 32636002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGACATGTTGCCATGGCTAMGAACAAGTTGGTAGTTACTGTGCCTTGC[G/A]TRAGTATKTTCAACTAAATCAGAGTGAAAGTGGAAAGTGAAGGAATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30942
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 198 950 4 17
ENSDART00000126952 Nonsense 198 927 4 16
Genomic Location (Zv9):
Chromosome 10 (position 33590347)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32691696
GRCz11 10 32635556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAACCTATGAGCTATTGGCAATCGACAAAGGTCTCTTGAACCACACC[A/T]GACTGCTTCACTCTGTGGTTTGTAATCATTTGCTGTATAAAGTGCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10242
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 569 950 11 17
ENSDART00000126952 Essential Splice Site 546 927 10 16
Genomic Location (Zv9):
Chromosome 10 (position 33580191)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32681540
GRCz11 10 32625400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGRATACAYAGACTTGAACCCCAGAAGACCGGGACGCAGCTGTGCAGG[T/C]ACACACTGTGGAAAACGCTACTGTWGAGATTTCATTAGACTGGCACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 674 950 12 17
ENSDART00000126952 Nonsense 651 927 11 16
Genomic Location (Zv9):
Chromosome 10 (position 33577070)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32678419
GRCz11 10 32622279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGAGATTACCTCAAGGCCAATAACATCTCAGAGACCTCCTTGTATCTT[G/T]GAAATCCTGAATGCGGGCCCGTTGGGTTTGATGATTCTTATTTGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 900 950 16 17
ENSDART00000126952 Nonsense 877 927 15 16
Genomic Location (Zv9):
Chromosome 10 (position 33568742)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32670091
GRCz11 10 32613951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGTGACCGTCTTCTAAGTGCCAGGTCTTCTAAATTATTTGGACTGACC[C/T]GATCYGTTGGACCCTTAAACAGATTACACACAAGTAAATGCTTYTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 910 950 16 17
ENSDART00000126952 Essential Splice Site 887 927 15 16
Genomic Location (Zv9):
Chromosome 10 (position 33568708)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32670057
GRCz11 10 32613917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATTTGGACTGACCCGATCCGTTGGACCCTTAAACAGATTACACACAA[G/A]TAAATGCTTTTTATTTAATGCATGTGAATATCCACAGCCTTCCATGATAT
Associated Phenotype:
Not determined