Busch Lab

ZMP

sdad1

Ensembl ID:
ENSDARG00000068903
ZFIN ID:
ZDB-GENE-021213-1
Description:
Protein SDA1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NV26]
Human Orthologue:
SDAD1
Human Description:
SDA1 domain containing 1 [Source:HGNC Symbol;Acc:25537]
Mouse Orthologue:
Sdad1
Mouse Description:
SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29527 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14966 Essential Splice Site Available for shipment Available now
sa13304 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29526
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Essential Splice Site 30 682 1 22
ENSDART00000142986 None None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8912736)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9291422
GRCz11 21 9384155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTTGCAAAATCTGATCAAGAGGGATCCGAAGTCCTACACCGAGGAGG[T/G]AAATAACTCGCTGTTTAACTTGTAAAGCAAAACAAATAAATAATGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29527
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Essential Splice Site 394 682 14 22
ENSDART00000142986 None None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8923782)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9280376
GRCz11 21 9373109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAATAACTTTGTTACAGACAGAAATTCAGGGGAGGTCATGACAGTTGGG[T/C]ATGTGCTATGTAAATATGAGTAACATACAATAAGGTTTAAATGTCTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14966
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Essential Splice Site 452 682 16 22
ENSDART00000142986 None None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8924142)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9280016
GRCz11 21 9372749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGCTCTTCAGAGACCTCAATCCAAAGATGCTAACCAGAAAAGACAGGG[T/C]GAGAAGTGTTTGCAGTTTTATATYATATTAAAATTGATCAAATCATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13304
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Nonsense 633 682 21 22
ENSDART00000142986 None None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8929544)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9274614
GRCz11 21 9367347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGACTGACAGGAAGGAGTTTACCAAAAAGAGAGGTAAACTAAACCCGTA[T/A]GCCAGCACCAGTAACAAGGAGAAGAAACGGAAGAAGAACTTCATGATGAT
Associated Phenotype:
Not determined