Busch Lab

ZMP

nrip1b

Ensembl ID:
ENSDARG00000068894
ZFIN ID:
ZDB-GENE-030131-4173
Description:
RIP140-B [Source:UniProtKB/TrEMBL;Acc:Q1L667]
Human Orthologue:
NRIP1
Human Description:
nuclear receptor interacting protein 1 [Source:HGNC Symbol;Acc:8001]
Mouse Orthologue:
Nrip1
Mouse Description:
nuclear receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1315213]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34964 Nonsense Mutation detected in F1 DNA Not yet available
sa7287 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4386
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099799 Nonsense 202 1000 1 3
Genomic Location (Zv9):
Chromosome 10 (position 39627100)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38317071
GRCz11 10 38260829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGAGGAAAAGCAAGCATCAGAACCATAACACTGTGCCTTATTGCCGA[C/T]AGAGCAACCAGAACCGAGGCTCTGATTCTCCTCGGTCCTCACAAAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34964
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099799 Nonsense 380 1000 1 3
Genomic Location (Zv9):
Chromosome 10 (position 39626566)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38316537
GRCz11 10 38260295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACTGCAGCAGTCTGTTGCTTCTACTTCTTAACAATCACAACTCCCAA[C/T]AGCAGCTCACCAGAAACGGACACCTAGAGGAAGACTGCGGCATCCTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7287
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099799 Essential Splice Site 711 1000 2 3
Genomic Location (Zv9):
Chromosome 10 (position 39625539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38315510
GRCz11 10 38259268
KASP Assay ID:
554-4524.1 (used for ordering genotyping assays)
KASP Sequence:
GGCAAGGGTGGNCTCTGCTAAGTGTGACAGCTCAAATGGACCTYCTCTGGA[C/G]CCTAACATCAAAAAGGAGCCAGTAGAAGAGAATCTTCAATCAGACCGCTT
Associated Phenotype:
Not determined