Busch Lab

ZMP

si:dkey-61p9.7

Ensembl ID:
ENSDARG00000068865
ZFIN ID:
ZDB-GENE-041210-241
Description:
hypothetical protein LOC100001227 [Source:RefSeq peptide;Acc:NP_001076412]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2152 Essential Splice Site F2 line generated Not yet available
sa20323 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2152
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099744 Essential Splice Site 75 324 7 15
Genomic Location (Zv9):
Chromosome 4 (position 61401114)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76218792
GRCz11 4 77662745
KASP Assay ID:
554-2606.1 (used for ordering genotyping assays)
KASP Sequence:
GACCTTCTCATGCTGTCTGTTCACCCGTCTGCTCTTTACTTGTCTTYTTA[A/C]GGAGAAATGTGACGGACTGTCAGATCTGCAGATTTATRCAACACAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20323
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099744 Nonsense 181 324 11 15
Genomic Location (Zv9):
Chromosome 4 (position 61404796)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76215110
GRCz11 4 77666427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGAATCTGAGCTGAGGAAGAGTTATGAGATGCTGCGCGTCAAGGAGTG[G/A]CCCAAGTGCCTGATGAGAATTAAAGACGGCGTTAAACAGGGAAAACTAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26368
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099744 Essential Splice Site 212 324 11 15
Genomic Location (Zv9):
Chromosome 4 (position 61404890)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76215016
GRCz11 4 77666521
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTAGAGGATGAAAAGACGGAGAAGGAAACCATTAAAAGAATGATGAAG[G/A]TGTGAAATCCTTCTCCAGAAAGATCCACACATAATGAGACTGTAAATCTG
Associated Phenotype:
Not determined