Busch Lab

ZMP

si:dkey-18a10.4

Ensembl ID:
ENSDARG00000068858
ZFIN IDs:
ZDB-GENE-080402-1, ZDB-GENE-091204-49
Description:
interleukin 2 receptor, gamma a [Source:RefSeq peptide;Acc:NP_001121743]
Human Orthologue:
IL2RG
Human Description:
interleukin 2 receptor, gamma [Source:HGNC Symbol;Acc:6010]
Mouse Orthologue:
Il2rg
Mouse Description:
interleukin 2 receptor, gamma chain Gene [Source:MGI Symbol;Acc:MGI:96551]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14683 Nonsense Available for shipment Available now
sa31788 Nonsense Available for shipment Available now
sa45415 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27636
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Essential Splice Site 22 362 1 8
ENSDART00000131873 Essential Splice Site 22 374 1 8
Genomic Location (Zv9):
Chromosome 10 (position 34585468)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33613326
GRCz11 10 33557186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCTTTTCTTTGGGAACTTTTGCACATTTTCAGCATCATCTGATCCAA[G/A]TGAGTATCACAGATTTGTCTTTTTAGAAAATCTGGATATTATTTGTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14683
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 45 362 2 8
ENSDART00000131873 Nonsense 45 374 2 8
Genomic Location (Zv9):
Chromosome 10 (position 34582241)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33610099
GRCz11 10 33553959
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAATCTGGACTATGTGAACTGCACATGGAGCGAACATCAGTACAATTA[C/A]AGTCTCAAGGGCGGGTATGTATTAMTGAAACAAGAAAGCATTTTNNTRAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 106 362 3 8
ENSDART00000131873 Nonsense 106 374 3 8
Genomic Location (Zv9):
Chromosome 10 (position 34581983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33609841
GRCz11 10 33553701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGTACCGTGACGATGGCAGTTTGGTGACGGAACAGGAACATATGCTG[A/T]AAGAATATGGTATGAGAAGCCATTCGTTTCTTGCTTTCTCAAGATTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45415
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 336 362 8 8
ENSDART00000131873 Nonsense 348 374 8 8
Genomic Location (Zv9):
Chromosome 10 (position 34572694)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33600552
GRCz11 10 33544412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATCCTCTCCAACCCAACAGACGTATCATCTGATTACCAAAGCATGCAC[A/T]GATATTCATCAGCCTCAACAATACCCGGATCTGCTGAACCCCTGCAAACC
Associated Phenotype:
Not determined