Busch Lab

ZMP

si:dkey-221j11.2

Ensembl ID:
ENSDARG00000068849
ZFIN ID:
ZDB-GENE-090312-104
Description:
Novel protien similar to H.sapiens FAM83H, family with sequence similarity 83, member H (FAM83H) [So
Human Orthologue:
FAM83H
Human Description:
family with sequence similarity 83, member H [Source:HGNC Symbol;Acc:24797]
Mouse Orthologue:
Fam83h
Mouse Description:
family with sequence similarity 83, member H Gene [Source:MGI Symbol;Acc:MGI:2145900]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa35575 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa28191 Nonsense Mutation detected in F1 DNA Not yet available
sa35574 Nonsense Mutation detected in F1 DNA Not yet available
sa42287 Nonsense Mutation detected in F1 DNA Not yet available
sa30974 Nonsense Mutation detected in F1 DNA Not yet available
sa35573 Nonsense Mutation detected in F1 DNA Not yet available
sa22372 Nonsense Available for shipment Available now
sa10399 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4529
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Essential Splice Site 148 2317 1 5
ENSDART00000135172 Essential Splice Site 148 302 1 4
Genomic Location (Zv9):
Chromosome 13 (position 43230191)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42451150
GRCz11 13 42577210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCCAGTATCAAGGAGCAAGTTCGTAGAATGATCAAGAATGCACAACAAG[T/A]GAGTTCAAGTGCACTAAGTAATATTTTATTAATGCATCAAAAAAGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35575
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Essential Splice Site 203 2317 2 5
ENSDART00000135172 Essential Splice Site 203 302 2 4
Genomic Location (Zv9):
Chromosome 13 (position 43225915)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42446874
GRCz11 13 42572934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTTGCAATGGTGAACAACTGTAGGGTTAATCTGGAGGAGATAAAAG[T/C]AAGTGGCATATGCCTTTTTAAATATGAGGCTTGGCGCAAATTTAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28191
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 795 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43222334)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42443293
GRCz11 13 42569353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATAGAGGGTGCTCAGGAAGAAAAAGACCTGCCTCAAACCACAGTGCCT[G/T]AAGGAAATAGCAAAAGGATGGAATCTCCATCAAATGCATTGCAAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 1472 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43220301)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42441260
GRCz11 13 42567320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCCTGCTGAAACAGAAGTAGACAATACCCTGAAATTTACAACACCATA[C/A]ACAGTTTCTTCCCAGAAGCCCAGTGCAACACAGAATGTTTCTTCAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42287
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 1586 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43219961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42440920
GRCz11 13 42566980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGCTGGAGTGGTAAAACAAACCACTCCAACATTCACAGACACGTCC[C/T]AGCAGACACCTAAATCAGAGACATACTTTTCCCAGAAAACACTTCCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30974
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 1614 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43219877)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42440836
GRCz11 13 42566896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAACACTTCCAATAGACAGAGACAACTCCCAGCACCCCACTGCAAAG[C/T]AGATGCAGTCCACACAGCAACACACTGCACAAGACAGCGACTCCTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35573
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 1762 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43219433)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42440392
GRCz11 13 42566452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAGCAAACTCTTCCCCGCAGACCATTGCAACTGAAACAGACTCTTCC[C/T]AACAGACCACTGTAATGGAAGAAAACCTTTTCCAGCAGACCACTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22372
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 2087 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43218458)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42439417
GRCz11 13 42565477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTTCACTTGTCAGTACTGGTGACGTAGATGTGAGCTCTACCCAGCCT[C/T]AAGTTTTACCAGAGCCTTGCCTTTCCTCAACTAAAATTACATCAAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10399
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099714 Nonsense 2215 2317 4 5
ENSDART00000135172 None None 302 None 4
Genomic Location (Zv9):
Chromosome 13 (position 43218073)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42439032
GRCz11 13 42565092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTAACCCATGATTYAGAAAATAAGTCTACTGTTGCAGACAGTCCAAAAT[T/A]GATTTTGTCTGCCCATCAGTCATCTACAGCGAATGTTATCTCATGCAGCA
Associated Phenotype:
Not determined