Busch Lab

ZMP

tlr7

Ensembl ID:
ENSDARG00000068812
ZFIN ID:
ZDB-GENE-040219-11
Description:
Toll-like receptor 7 [Source:UniProtKB/TrEMBL;Acc:Q6TQH6]
Human Orthologue:
TLR7
Human Description:
toll-like receptor 7 [Source:HGNC Symbol;Acc:15631]
Mouse Orthologue:
Tlr7
Mouse Description:
toll-like receptor 7 Gene [Source:MGI Symbol;Acc:MGI:2176882]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7215 Nonsense Mutation detected in F1 DNA Not yet available
sa41556 Nonsense Mutation detected in F1 DNA Not yet available
sa11566 Nonsense Available for shipment Available now
sa31752 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7215
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 378 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56164815)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54579199
GRCz11 9 54145112
KASP Assay ID:
554-4709.1 (used for ordering genotyping assays)
KASP Sequence:
GAATCTTTCAGTCAGCTTAAATCWCTTAGAGTGCTAAGAATCAGAGGATA[T/A]GTGTTTCAAGAACTCAAATTGCAAGACATCCAACCGCTAACTAACTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41556
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 768 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56165983)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54580367
GRCz11 9 54146280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCCTCAAAATCCTAGATCTCAGTTACAATTCCATCCAGTTTATCGAT[G/T]AATCAAGCTTCCCGGAAAATGTTATAGACCATCTGCAAACTCTTTACCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27504
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 932 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56166476)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54580860
GRCz11 9 54146773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTAAGAGTCCACCTAGAGGACAAGGGTGATCCCAGGATGAACCTTTGTT[T/A]GGAGGAACGGGATTGGGTTCCTGGATGTCCACTTATTGAGAATCTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 952 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56166535)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54580919
GRCz11 9 54146832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGATTGGGTTCCTGGATGTCCACTTATTGAGMATCTTTCCCAAAGTATA[C/T]AGTTGAGCCAGCGTACGGTTTTCATCCTGACTGAGAGGTATATAAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31752
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 1019 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56166737)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54581121
GRCz11 9 54147034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATATCTCAGACTGAGGAAGAGGTTGTATAAAAAGTCAGTTTTGGAGT[G/A]GCCAAGGAACCCACAGGCACAAAGGTACTTTTGGTTCAGTCTCAGAAGCC
Associated Phenotype:
Not determined