Busch Lab

ZMP

slc6a17

Ensembl ID:
ENSDARG00000068787
ZFIN ID:
ZDB-GENE-030131-8187
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:A5WUQ3]
Human Orthologue:
SLC6A17
Human Description:
solute carrier family 6, member 17 [Source:HGNC Symbol;Acc:31399]
Mouse Orthologue:
Slc6a17
Mouse Description:
solute carrier family 6 (neurotransmitter transporter), member 17 Gene [Source:MGI Symbol;Acc:MGI:24

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11421 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099607 Essential Splice Site 438 732 7 11
Genomic Location (Zv9):
Chromosome 8 (position 25736958)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24864876
GRCz11 8 24884015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGGACTRGAGCAGTGTTTGCTGGAGGATGAGCTCAATAAGGCAGGT[G/T]TTCAGCCCATGAACTATCTGCTTTCATTCACAAGTTTCAGCGATTATTAT
Associated Phenotype:
Not determined