Busch Lab

ZMP

eif2ak2

Ensembl ID:
ENSDARG00000068729
ZFIN ID:
ZDB-GENE-080422-1
Description:
interferon-induced, double-stranded RNA-activated protein kinase [Source:RefSeq peptide;Acc:NP_0011
Human Orthologue:
EIF2AK2
Human Description:
eukaryotic translation initiation factor 2-alpha kinase 2 [Source:HGNC Symbol;Acc:9437]
Mouse Orthologue:
Eif2ak2
Mouse Description:
eukaryotic translation initiation factor 2-alpha kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1353449]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42308 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28209
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099517 Nonsense 304 682 9 19
Genomic Location (Zv9):
Chromosome 13 (position 51201106)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49912203
GRCz11 13 50225446
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATATAGAAATAAAATAAGAAACTGTTGATGTGTTTTGTAGTAAATCT[G/T]AAGACGTCCAGCGCTCAGCGAACGCCTCCAGCACAAGTAATTTCATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099517 Essential Splice Site 470 682 14 19
Genomic Location (Zv9):
Chromosome 13 (position 51197032)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49908129
GRCz11 13 50221372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAGAGGACACAGCATACAAACACGAGTCGTCAGAGAGCTTCTCAGA[G/T]TAATGCACCAAACACAAGCACCTGCTCAAACTAACACAGGGCCTACAGAA
Associated Phenotype:
Not determined