Busch Lab

ZMP

zgc:153423

Ensembl ID:
ENSDARG00000068716
ZFIN ID:
ZDB-GENE-061027-344
Description:
hypothetical protein LOC768297 [Source:RefSeq peptide;Acc:NP_001070929]
Human Orthologue:
CUEDC1
Human Description:
CUE domain containing 1 [Source:HGNC Symbol;Acc:31350]
Mouse Orthologue:
Cuedc1
Mouse Description:
CUE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2144281]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14130 Essential Splice Site Available for shipment Available now
sa34959 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14130
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099487 Essential Splice Site 259 380 6 11
ENSDART00000114909 None None 380 None 11
ENSDART00000131777 Essential Splice Site 260 381 6 11

The following transcripts of ENSDARG00000068716 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 38492711)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37215726
GRCz11 10 37159484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACACACAGTGTGGTCATTCATCTGCTTGCACGGAGAACTCAGCCGAAG[G/T]TAGATTCCCTTCATCTTCATCCATCAGCCACGCATATACACCAGCTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34959
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099487 Essential Splice Site 337 380 None 11
ENSDART00000114909 Essential Splice Site 337 380 None 11
ENSDART00000131777 Essential Splice Site 338 381 None 11

The following transcripts of ENSDARG00000068716 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 38493329)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37216344
GRCz11 10 37160102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTCATGTTTCCAGCCTTGACAGTCACTGCCAGAGGGTTGCGCCTACG[T/C]ATGTTGTGTAGAGATGTCAATGCTAACGTGCTTGCGTGTGTGTGTGTGTT
Associated Phenotype:
Not determined