Busch Lab

ZMP

tmem168a

Ensembl ID:
ENSDARG00000068705
ZFIN ID:
ZDB-GENE-050419-97
Description:
Transmembrane protein 168-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LUD1]
Human Orthologue:
TMEM168
Human Description:
transmembrane protein 168 [Source:HGNC Symbol;Acc:25826]
Mouse Orthologue:
Tmem168
Mouse Description:
transmembrane protein 168 Gene [Source:MGI Symbol;Acc:MGI:1921794]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11468 Nonsense Available for shipment Available now
sa6927 Nonsense Mutation detected in F1 DNA Not yet available
sa44581 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11468
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099464 Nonsense 452 681 3 4
Genomic Location (Zv9):
Chromosome 4 (position 6133020)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6735564
GRCz11 4 6744134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCAGCGACTCTTCTCCCATCACCTTATCCAGACGTTCGGGTGTGACTA[T/A]TCCACCAGTCTAAGCCTCGAGACCCTGCTTGTCAAGCTGCGCTCCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6927
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099464 Nonsense 600 681 4 4
Genomic Location (Zv9):
Chromosome 4 (position 6137985)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6740529
GRCz11 4 6749099
KASP Assay ID:
554-5142.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAGYGGCGTSCAGTGGTCTGAGAGAGGAAGGGTCATATCGGCTATATA[T/A]GGAGTCTCCAAACCCTGGAGCGACTATGCCCTTCACCTGCCCACCGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44581
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099464 Nonsense 632 681 4 4
Genomic Location (Zv9):
Chromosome 4 (position 6138081)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6740625
GRCz11 4 6749195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGCGATGTGGCCAAGCACTGGAAAACACACTTCCCCAAAACCACATA[T/A]CCATTGGTGGCTGTAGCAAACTGGTGCTGCGGACTCAACCTCCTATGGCT
Associated Phenotype:
Not determined